HUGE

Gene/Protein Characteristic Table for KIAA1750

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00910
Accession No. :	AB051537
Description :	TSPY-like 5.
HUGO Gene Name :	TSPY-like 5 (TSPYL5)
Clone Name :	pj02374 [Vector Info]
Flexi ORF Clone :	pF1KSDA1750
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4414 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3117 bp

Genome contig ID gi51511724r_98254878
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAAACCTGTATCTCTGTTATATTTCTGATTTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAATTGGAAGGTTTTTAAACAGAGGCTGGGCAGCTGAGAGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 98354878 98359291 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 431 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW91759	4.5e-156	100.0	TSPY-like 5 [Ho...	Homo sapiens
XP_519872	6.9e-154	99.1	TSPY-like 5 [Pa...	Pan troglodytes
Q86VY4	1.8e-151	100.0	Testis-specific...	Homo sapiens
AAH45630	2e-151	99.8	TSPY-like 5 [Ho...	Homo sapiens
XP_001092365	1.8e-149	98.6	similar to TSPY...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018264	7.3e-31	42.9	KIAA0721

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002164 216 404 PF00956 Nucleosome assembly protein (NAP)

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002164	216	404	PF00956	Nucleosome assembly protein (NAP)

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAGCTGAGAACTTGGCACTG

Primer_r
: TCTATGACATGGCTGCCTTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3117 bp
Genome contig ID	gi51511724r_98254878
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAAACCTGTATCTCTGTTATATTTCTGATTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAATTGGAAGGTTTTTAAACAGAGGCTGGGCAGCTGAGAGAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	98354878	98359291	1	99.0	Perfect prediction

Primer_f	: GTAGCTGAGAACTTGGCACTG
Primer_r	: TCTATGACATGGCTGCCTTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1750

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information