HUGE

Gene/Protein Characteristic Table for KIAA0721

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00118
Accession No. :	AB018264
Description :	Testis-specific Y-encoded-like protein 4.
HUGO Gene Name :	TSPY-like 4 (TSPYL4)
Clone Name :	hk01908 [Vector Info]
Flexi ORF Clone :	pF1KA0721
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4098 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 433 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB55881	5.8e-161	100.0	NAP (Nucleosome...	Homo sapiens
XP_518704	1.6e-158	99.1	TSPY-like 4 [Pa...	Pan troglodytes
Q9UJ04	5.3e-154	100.0	Testis-specific...	Homo sapiens
BAB41148	2.1e-147	96.4	hypothetical pr...	Macaca fascicularis
XP_001502707	6.7e-126	83.1	similar to TSPY...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051537	1.1e-29	42.9	KIAA1750

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002164 220 410 PF00956 Nucleosome assembly protein (NAP)

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002164	220	410	PF00956	Nucleosome assembly protein (NAP)

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGAGGGTTTAGGAGGTCTGA

Primer_r
: TCCTGTGAGCCTTTCCAAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGAGGGTTTAGGAGGTCTGA
Primer_r	: TCCTGTGAGCCTTTCCAAACC
PCR product length	: 120 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0721

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information