HUGE

Gene/Protein Characteristic Table for KIAA1759

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00913
Accession No. :	AB051546
Description :	CK056_HUMAN Isoform 2 of Q8N612 - Homo sapiens.
HUGO Gene Name :	family with sequence similarity 160, member A2 (FAM160A2)
Clone Name :	fh22011s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1759
Source :	Human fetal brain
Note :	We replaced fh22011, former representative clones for KIAA1759 with fh22011s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3354 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 171 bp

Genome contig ID gi51511727r_6089141
PolyA signal sequence
(TATAAA,-29)
+----*----+----*----+----*----+----
AATATGTATAAAAGGGAAATCTCTATTCTGTGCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTTCTTTCCCATTTTTTTCTGTGGGGCTGGGGCCCCAGAAAAGGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 6189141 6212422 12 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N612	100.0	UPF0518 protein...	Homo sapiens
AAH30825	99.9	FAM160A2 protei...	Homo sapiens
XP_001110422	98.6	similar to CG35...	Macaca mulatta
Q5R8V2	98.3	UPF0518 protein...	Pongo abelii
XP_862521	95.9	similar to CG35...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTTCCTGCTCAACACCAAC

Primer_r
: CCACGGGCAATGAGGTACTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: CCR
Primer_f	: AAGGTTCGTCTGGTGCCAAAG
Primer_r	: GACAGGTGAAGCTCTCGTAGG
PCR product length	: 199 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	171 bp
Genome contig ID	gi51511727r_6089141
PolyA signal sequence (TATAAA,-29)	+--------+--------+----*----+---- AATATGTATAAAAGGGAAATCTCTATTCTGTGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTCTTTCCCATTTTTTTCTGTGGGGCTGGGGCCCCAGAAAAGGTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	6189141	6212422	12	99.8	Perfect prediction

Primer_f	: TCTTTCCTGCTCAACACCAAC
Primer_r	: CCACGGGCAATGAGGTACTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1759

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information