HUGE

Gene/Protein Characteristic Table for KIAA1770

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB051557
Description :	KPL2 protein isoform 1.
HUGO Gene Name :
Clone Name :	pj01645 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4105 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 309 bp

Genome contig ID gi51511721f_35626905
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
CTGAGTTGAAAATAAAAGCGCTTTCACTTTGATAG
Flanking genome sequence
(216996 - 217045)
----+----*----+----*----+----*----+----*----+----*
AATGTAGATTGTGTATCTTGACTTCTCAATGATAGCAAGTTACATTTTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 35726905 35843899 27 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1307 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C093	99.2	Sperm flagellar...	Homo sapiens
EAW55923	99.7	KPL2 protein, i...	Homo sapiens
XP_546353	79.1	similar to KPL2...	Canis lupus fam...
XP_001500121	78.4	similar to KPL2...	Equus caballus
Q2IA00	77.6	Sperm flagellar...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008906 1185 1281 PF05699 HAT dimerisation

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008906	1185	1281	PF05699	HAT dimerisation

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAGCAATGGTTTTCAGAGCC

Primer_r
: GTGTAGGAAGTGGAAGCTCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: CCR
Primer_f	: ATTGGTAGAGTGTCAGTATCC
Primer_r	: GACCTATCTCAAATCTCCGTG
PCR product length	: 188 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	309 bp
Genome contig ID	gi51511721f_35626905
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTGAGTTGAAAATAAAAGCGCTTTCACTTTGATAG
Flanking genome sequence (216996 - 217045)	----+--------+--------+--------+--------+----* AATGTAGATTGTGTATCTTGACTTCTCAATGATAGCAAGTTACATTTTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	35726905	35843899	27	99.9	Perfect prediction

Primer_f	: GGAGCAATGGTTTTCAGAGCC
Primer_r	: GTGTAGGAAGTGGAAGCTCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1770

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information