HUGE |
Gene/Protein Characteristic Table for KIAA1788 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01180 |
---|---|
Accession No. : | AB058691 |
Description : | Homeobox protein aristaless-like 4. |
HUGO Gene Name : | ALX homeobox 4 (ALX4) |
Clone Name : | fh22801 [Vector Info] |
Flexi ORF Clone : | pF1KA1788
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5654 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4411 bp Genome contig ID gi51511727r_44138570 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
GTTGTTATTTGCAATAAACTCCTTCTCCTTCCTCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TCTCAACTGGAATCTGTCTGTTTTGTTCCTGACTTGTGACAGATGAAATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 44238570 44288195 4 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 413 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATAGCACTTGGAGGACATGG | |
: CGCAGTGTCTTTGAGCTAACC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: CCR | |
: AATAGCACTTGGAGGACATGG | |
: CGCAGTGTCTTTGAGCTAACC | |
: 131 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |