HUGE

Gene/Protein Characteristic Table for KIAA1796

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06352
Accession No. :	AB058699
Description :	phytanoyl-CoA 2-hydroxylase interacting protein-like.
HUGO Gene Name :	phytanoyl-CoA 2-hydroxylase interacting protein-like (PHYHIPL)
Clone Name :	fj18826 [Vector Info]
Flexi ORF Clone :	pF1KA1796
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4742 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4004 bp

Genome contig ID gi89161187f_60566339
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCCCAGGTGACAGAGTGAGACTCCGTCTCAAAAG
Flanking genome sequence
(167580 - 167629)
----+----*----+----*----+----*----+----*----+----*
AAACAGAAAAGTGTCTGTTCATGTCCTTTGCCTACTTCTTTTATGAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 60666339 60733917 7 98.5 Internal No-hit

Features of the protein sequence	Description

Length: 245 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ88529	4.1e-111	100.0	EELP6309 [Homo ...	Homo sapiens
EAW54184	4.3e-111	100.0	phytanoyl-CoA 2...	Homo sapiens
Q96FC7	4.5e-111	100.0	Phytanoyl-CoA h...	Homo sapiens
AAY18942	4.7e-111	100.0	DKFZp761M0113 [...	synthetic construct
XP_001502143	5.1e-111	99.6	phytanoyl-CoA 2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87463	9.5e-85	75.1	KIAA0273

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCATTTAGGGTCTGTCTTAC

Primer_r
: GAACCACCACAATTTAGACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4004 bp
Genome contig ID	gi89161187f_60566339
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCCCAGGTGACAGAGTGAGACTCCGTCTCAAAAG
Flanking genome sequence (167580 - 167629)	----+--------+--------+--------+--------+----* AAACAGAAAAGTGTCTGTTCATGTCCTTTGCCTACTTCTTTTATGAGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	60666339	60733917	7	98.5	Internal No-hit

Primer_f	: AGCATTTAGGGTCTGTCTTAC
Primer_r	: GAACCACCACAATTTAGACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1796

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information