HUGE |
Gene/Protein Characteristic Table for KIAA0273 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00487 |
---|---|
Accession No. : | D87463 |
Description : | Phytanoyl-CoA hydroxylase-interacting protein. |
HUGO Gene Name : | phytanoyl-CoA 2-hydroxylase interacting protein (PHYHIP) |
Clone Name : | ha06723 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0273
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3040 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1644 bp Genome contig ID gi51511724r_22033167 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATAAACCACCATGGCCTGAGGGCCCTGCTCGTCTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTCCATTTGAGCTGCTGTAACAAAATACCACACATTGGGTGGCTCAGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 22133167 22145505 6 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 356 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 8 |
: Genebridge 4 | |
: GTGAGGGACAGGTGGACAACG | |
: CTGGGCCATGTTCTCTCCTTC | |
: 131 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |