HUGE

Gene/Protein Characteristic Table for KIAA1803

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00282
Accession No. :	AB058706
Description :	Zinc finger protein 462.
HUGO Gene Name :	zinc finger protein 462 (ZNF462)
Clone Name :	fj22564s1 [Vector Info]
Flexi ORF Clone :	pF1KA1803
Source :	Human fetal brain
Note :	We replaced fj22564, former representative clones for KIAA1803 with fj22564s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4691 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 452 bp

Genome contig ID gi89161216f_108629480
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAGCTTTTTCAAGACCTAACTGCAGCCGCTTTGGG
Flanking genome sequence
(184106 - 184155)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAACAAAAAACAAAAAACAGAAAACAAAAAAAAAAAAACTGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 108729480 108813584 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW59010	100.0	zinc finger pro...	Homo sapiens
CAI14941	99.9	zinc finger pro...	Homo sapiens
EAW59011	99.9	zinc finger pro...	Homo sapiens
XP_001109212	99.4	zinc finger pro...	Macaca mulatta
XP_867474	95.7	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB107355	2.1e-09	23.2	KIAA2033
AB058709	2e-07	27.1	KIAA1806
AB046831	2.4e-07	24.0	KIAA1611
AB075828	7.6e-07	24.3	KIAA1948
AB037809	7.1e-06	27.7	KIAA1388

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 737 759 PF00096 Zinc finger

IPR007087 897 919 PF00096 Zinc finger

IPR007087 931 953 PF00096 Zinc finger

IPR007087 1206 1228 PF00096 Zinc finger

IPR007087 1320 1342 PF00096 Zinc finger

HMMSmart IPR015880 38 61 SM00355 Zinc finger

IPR015880 110 133 SM00355 Zinc finger

IPR015880 157 180 SM00355 Zinc finger

IPR015880 214 237 SM00355 Zinc finger

IPR015880 315 338 SM00355 Zinc finger

IPR015880 360 383 SM00355 Zinc finger

IPR015880 422 445 SM00355 Zinc finger

IPR015880 505 528 SM00355 Zinc finger

IPR015880 542 565 SM00355 Zinc finger

IPR015880 612 635 SM00355 Zinc finger

IPR015880 691 715 SM00355 Zinc finger

IPR015880 737 759 SM00355 Zinc finger

IPR015880 813 835 SM00355 Zinc finger

IPR015880 897 919 SM00355 Zinc finger

IPR015880 931 953 SM00355 Zinc finger

IPR015880 960 983 SM00355 Zinc finger

IPR015880 989 1012 SM00355 Zinc finger

IPR015880 1097 1120 SM00355 Zinc finger

IPR015880 1126 1149 SM00355 Zinc finger

IPR015880 1160 1182 SM00355 Zinc finger

IPR015880 1206 1228 SM00355 Zinc finger

IPR015880 1234 1257 SM00355 Zinc finger

IPR015880 1320 1342 SM00355 Zinc finger

ProfileScan IPR007087 315 343 PS50157 Zinc finger

IPR007087 737 764 PS50157 Zinc finger

IPR007087 897 919 PS50157 Zinc finger

IPR007087 931 959 PS50157 Zinc finger

IPR007087 960 988 PS50157 Zinc finger

IPR007087 1206 1233 PS50157 Zinc finger

IPR007087 1234 1262 PS50157 Zinc finger

IPR007087 1320 1342 PS50157 Zinc finger

ScanRegExp IPR007087 317 338 PS00028 Zinc finger

IPR007087 507 528 PS00028 Zinc finger

IPR007087 739 759 PS00028 Zinc finger

IPR007087 899 919 PS00028 Zinc finger

IPR007087 1208 1228 PS00028 Zinc finger

IPR007087 1322 1342 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	737	759	PF00096	Zinc finger
IPR007087	897	919	PF00096	Zinc finger
IPR007087	931	953	PF00096	Zinc finger
IPR007087	1206	1228	PF00096	Zinc finger
IPR007087	1320	1342	PF00096	Zinc finger
HMMSmart	IPR015880	38	61	SM00355	Zinc finger
IPR015880	110	133	SM00355	Zinc finger
IPR015880	157	180	SM00355	Zinc finger
IPR015880	214	237	SM00355	Zinc finger
IPR015880	315	338	SM00355	Zinc finger
IPR015880	360	383	SM00355	Zinc finger
IPR015880	422	445	SM00355	Zinc finger
IPR015880	505	528	SM00355	Zinc finger
IPR015880	542	565	SM00355	Zinc finger
IPR015880	612	635	SM00355	Zinc finger
IPR015880	691	715	SM00355	Zinc finger
IPR015880	737	759	SM00355	Zinc finger
IPR015880	813	835	SM00355	Zinc finger
IPR015880	897	919	SM00355	Zinc finger
IPR015880	931	953	SM00355	Zinc finger
IPR015880	960	983	SM00355	Zinc finger
IPR015880	989	1012	SM00355	Zinc finger
IPR015880	1097	1120	SM00355	Zinc finger
IPR015880	1126	1149	SM00355	Zinc finger
IPR015880	1160	1182	SM00355	Zinc finger
IPR015880	1206	1228	SM00355	Zinc finger
IPR015880	1234	1257	SM00355	Zinc finger
IPR015880	1320	1342	SM00355	Zinc finger
ProfileScan	IPR007087	315	343	PS50157	Zinc finger
IPR007087	737	764	PS50157	Zinc finger
IPR007087	897	919	PS50157	Zinc finger
IPR007087	931	959	PS50157	Zinc finger
IPR007087	960	988	PS50157	Zinc finger
IPR007087	1206	1233	PS50157	Zinc finger
IPR007087	1234	1262	PS50157	Zinc finger
IPR007087	1320	1342	PS50157	Zinc finger
ScanRegExp	IPR007087	317	338	PS00028	Zinc finger
IPR007087	507	528	PS00028	Zinc finger
IPR007087	739	759	PS00028	Zinc finger
IPR007087	899	919	PS00028	Zinc finger
IPR007087	1208	1228	PS00028	Zinc finger
IPR007087	1322	1342	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAACTTGGATCAGCTGGAAC

Primer_r
: CCCGTCCACAAAATTCACATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	452 bp
Genome contig ID	gi89161216f_108629480
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGCTTTTTCAAGACCTAACTGCAGCCGCTTTGGG
Flanking genome sequence (184106 - 184155)	----+--------+--------+--------+--------+----* AAAAAAAAACAAAAAACAAAAAACAGAAAACAAAAAAAAAAAAACTGCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	108729480	108813584	11	99.4	Perfect prediction

Primer_f	: TTAACTTGGATCAGCTGGAAC
Primer_r	: CCCGTCCACAAAATTCACATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1803

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information