HUGE

Gene/Protein Characteristic Table for KIAA1808

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04018
Accession No. :	AB058711
Description :	Actin-binding LIM protein 2.
HUGO Gene Name :	actin binding LIM protein family, member 2 (ABLIM2)
Clone Name :	fk00917 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3282 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1661 bp

Genome contig ID gi89161207r_7917956
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCAGGAAGCCTGGAAAATAAAAGACGATGCATTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTGCGGAAGTACAAGATCACTTGTTATGAACTTGTGTGATTTTAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 8017956 8159176 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAG38375	3.9e-206	100.0	actin binding L...	Homo sapiens
CAG38378	2.6e-191	91.9	actin binding L...	Mus musculus
CAG28315	4.6e-190	91.3	actin binding L...	Rattus norvegicus
Q6H8Q1	1.5e-181	93.1	Actin-binding L...	Homo sapiens
Q8BL65	7.5e-167	85.5	Actin-binding L...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31883	9.3e-52	50.7	KIAA0059
AB020650	7.5e-47	49.5	KIAA0843
AB014513	0.00048	30.7	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001781 1 45 PD000094 Zinc finger

IPR001781 48 101 PD000094 Zinc finger

IPR001781 120 174 PD000094 Zinc finger

IPR001781 178 216 PD000094 Zinc finger

HMMPfam IPR001781 1 47 PF00412 Zinc finger

IPR001781 50 107 PF00412 Zinc finger

IPR001781 120 176 PF00412 Zinc finger

IPR001781 179 237 PF00412 Zinc finger

IPR003128 504 539 PF02209 Villin headpiece

HMMSmart IPR001781 1 41 SM00132 Zinc finger

IPR001781 49 101 SM00132 Zinc finger

IPR001781 119 170 SM00132 Zinc finger

IPR001781 178 230 SM00132 Zinc finger

IPR003128 504 539 SM00153 Villin headpiece

ProfileScan IPR001781 1 47 PS50023 Zinc finger

IPR001781 48 108 PS50023 Zinc finger

IPR001781 118 177 PS50023 Zinc finger

IPR001781 178 237 PS50023 Zinc finger

IPR003128 471 539 PS51089 Villin headpiece

ScanRegExp IPR001781 50 83 PS00478 Zinc finger

IPR001781 120 154 PS00478 Zinc finger

IPR001781 179 212 PS00478 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	1	45	PD000094	Zinc finger
IPR001781	48	101	PD000094	Zinc finger
IPR001781	120	174	PD000094	Zinc finger
IPR001781	178	216	PD000094	Zinc finger
HMMPfam	IPR001781	1	47	PF00412	Zinc finger
IPR001781	50	107	PF00412	Zinc finger
IPR001781	120	176	PF00412	Zinc finger
IPR001781	179	237	PF00412	Zinc finger
IPR003128	504	539	PF02209	Villin headpiece
HMMSmart	IPR001781	1	41	SM00132	Zinc finger
IPR001781	49	101	SM00132	Zinc finger
IPR001781	119	170	SM00132	Zinc finger
IPR001781	178	230	SM00132	Zinc finger
IPR003128	504	539	SM00153	Villin headpiece
ProfileScan	IPR001781	1	47	PS50023	Zinc finger
IPR001781	48	108	PS50023	Zinc finger
IPR001781	118	177	PS50023	Zinc finger
IPR001781	178	237	PS50023	Zinc finger
IPR003128	471	539	PS51089	Villin headpiece
ScanRegExp	IPR001781	50	83	PS00478	Zinc finger
IPR001781	120	154	PS00478	Zinc finger
IPR001781	179	212	PS00478	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAACCTTAAAGACAGACCCC

Primer_r
: ACAAGGACGGTGCATCAAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1661 bp
Genome contig ID	gi89161207r_7917956
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCAGGAAGCCTGGAAAATAAAAGACGATGCATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTGCGGAAGTACAAGATCACTTGTTATGAACTTGTGTGATTTTAAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	8017956	8159176	16	99.2	Perfect prediction

Primer_f	: GTAACCTTAAAGACAGACCCC
Primer_r	: ACAAGGACGGTGCATCAAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1808

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information