HUGE |
Gene/Protein Characteristic Table for KIAA0843 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00653 |
---|---|
Accession No. : | AB020650 |
Description : | Actin-binding LIM protein 3. |
HUGO Gene Name : | actin binding LIM protein family, member 3 (ABLIM3) |
Clone Name : | hk05155 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0843
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4256 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2032 bp Genome contig ID gi51511721f_148401326 PolyA signal sequence
(CATAAA,-25) +----*----+----*----+----*----+----
TTTTGTTTCCCATAAAAGCACATCATTTCAACCCTFlanking genome sequence
(218868 - 218917) ----+----*----+----*----+----*----+----*----+----*
AAACCTGTGTGCTTCTGTTGTTTCTTGTGTGGGAGTGGAAATGACTGACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 148501326 148620192 23 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 691 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTGCTGTGTTCTCATGTAGG | |
: AACCAGTGACAATAAGGCAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: TCTGCTGTGTTCTCATGTAGG | |
: AACCAGTGACAATAAGGCAAC | |
: 135 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |