HUGE

Gene/Protein Characteristic Table for KIAA0843

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00653
Accession No. :	AB020650
Description :	Actin-binding LIM protein 3.
HUGO Gene Name :	actin binding LIM protein family, member 3 (ABLIM3)
Clone Name :	hk05155 [Vector Info]
Flexi ORF Clone :	pF1KSDA0843
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4256 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2032 bp

Genome contig ID gi51511721f_148401326
PolyA signal sequence
(CATAAA,-25)
+----*----+----*----+----*----+----
TTTTGTTTCCCATAAAAGCACATCATTTCAACCCT
Flanking genome sequence
(218868 - 218917)
----+----*----+----*----+----*----+----*----+----*
AAACCTGTGTGCTTCTGTTGTTTCTTGTGTGGGAGTGGAAATGACTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 148501326 148620192 23 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 691 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94929	100.0	Actin-binding L...	Homo sapiens
BAF82425	99.9	unnamed protein...	Homo sapiens
XP_001162953	99.9	actin binding L...	Pan troglodytes
XP_855146	98.4	similar to Acti...	Canis lupus fam...
AAI42520	98.1	ABLIM3 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D31883	4.6e-76	52.8	KIAA0059
AB058711	3e-50	49.5	KIAA1808
AB014513	0.00011	31.1	KIAA0613

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001781 31 85 PD000094 Zinc finger

IPR001781 88 141 PD000094 Zinc finger

IPR001781 158 211 PD000094 Zinc finger

IPR001781 217 255 PD000094 Zinc finger

HMMPfam IPR001781 31 87 PF00412 Zinc finger

IPR001781 90 146 PF00412 Zinc finger

IPR001781 159 215 PF00412 Zinc finger

IPR001781 218 275 PF00412 Zinc finger

IPR003128 656 691 PF02209 Villin headpiece

HMMSmart IPR001781 30 81 SM00132 Zinc finger

IPR001781 89 141 SM00132 Zinc finger

IPR001781 158 209 SM00132 Zinc finger

IPR001781 217 269 SM00132 Zinc finger

IPR003128 656 691 SM00153 Villin headpiece

ProfileScan IPR001781 29 88 PS50023 Zinc finger

IPR001781 89 148 PS50023 Zinc finger

IPR001781 157 216 PS50023 Zinc finger

IPR001781 217 276 PS50023 Zinc finger

IPR003128 623 691 PS51089 Villin headpiece

ScanRegExp IPR001781 31 64 PS00478 Zinc finger

IPR001781 90 123 PS00478 Zinc finger

IPR001781 159 193 PS00478 Zinc finger

IPR001781 218 251 PS00478 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001781	31	85	PD000094	Zinc finger
IPR001781	88	141	PD000094	Zinc finger
IPR001781	158	211	PD000094	Zinc finger
IPR001781	217	255	PD000094	Zinc finger
HMMPfam	IPR001781	31	87	PF00412	Zinc finger
IPR001781	90	146	PF00412	Zinc finger
IPR001781	159	215	PF00412	Zinc finger
IPR001781	218	275	PF00412	Zinc finger
IPR003128	656	691	PF02209	Villin headpiece
HMMSmart	IPR001781	30	81	SM00132	Zinc finger
IPR001781	89	141	SM00132	Zinc finger
IPR001781	158	209	SM00132	Zinc finger
IPR001781	217	269	SM00132	Zinc finger
IPR003128	656	691	SM00153	Villin headpiece
ProfileScan	IPR001781	29	88	PS50023	Zinc finger
IPR001781	89	148	PS50023	Zinc finger
IPR001781	157	216	PS50023	Zinc finger
IPR001781	217	276	PS50023	Zinc finger
IPR003128	623	691	PS51089	Villin headpiece
ScanRegExp	IPR001781	31	64	PS00478	Zinc finger
IPR001781	90	123	PS00478	Zinc finger
IPR001781	159	193	PS00478	Zinc finger
IPR001781	218	251	PS00478	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTGCTGTGTTCTCATGTAGG

Primer_r
: AACCAGTGACAATAAGGCAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTGCTGTGTTCTCATGTAGG
Primer_r	: AACCAGTGACAATAAGGCAAC
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2032 bp
Genome contig ID	gi51511721f_148401326
PolyA signal sequence (CATAAA,-25)	+--------+--------+----*----+---- TTTTGTTTCCCATAAAAGCACATCATTTCAACCCT
Flanking genome sequence (218868 - 218917)	----+--------+--------+--------+--------+----* AAACCTGTGTGCTTCTGTTGTTTCTTGTGTGGGAGTGGAAATGACTGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	148501326	148620192	23	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0843

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information