HUGE

Gene/Protein Characteristic Table for KIAA1814

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04826
Accession No. :	AB058717
Description :	Histone-lysine N-methyltransferase, H3 lysine-79 specific.
HUGO Gene Name :	DOT1-like, histone H3 methyltransferase (S. cerevisiae) (DOT1L)
Clone Name :	ph00952 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 5576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1661 bp

Genome contig ID gi42406306f_2061699
PolyA signal sequence
(GATAAA,-22)
+----*----+----*----+----*----+----
GTCGATAGTTTTAGATAAAGTATTTATCATTTTTT
Flanking genome sequence
(119310 - 119359)
----+----*----+----*----+----*----+----*----+----*
AAAAAGTATAAACAATTCTGACTTATTTTATTCCATCTAAGTGGTAAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 2161699 2181007 15 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1285 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69409	99.8	DOT1-like, hist...	Homo sapiens
Q8TEK3	99.8	Histone-lysine ...	Homo sapiens
XP_001097213	97.0	DOT1-like, hist...	Macaca mulatta
BAB84946	99.1	FLJ00192 protei...	Homo sapiens
AAM88322	99.9	DOT1-like prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAGGGTGGCTTTAGCTGGAC

Primer_r
: CAGCTCCTCTAACCACAACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTAGGGTGGCTTTAGCTGGAC
Primer_r	: CAGCTCCTCTAACCACAACAG
PCR product length	: 95 bp
PCR conditions	: 15 °C66 sec60 °C30 sec134 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1661 bp
Genome contig ID	gi42406306f_2061699
PolyA signal sequence (GATAAA,-22)	+--------+--------+----*----+---- GTCGATAGTTTTAGATAAAGTATTTATCATTTTTT
Flanking genome sequence (119310 - 119359)	----+--------+--------+--------+--------+----* AAAAAGTATAAACAATTCTGACTTATTTTATTCCATCTAAGTGGTAAAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	2161699	2181007	15	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1814

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information