HUGE |
Gene/Protein Characteristic Table for KIAA1827 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07489 |
---|---|
Accession No. : | AB058730 |
Description : | Zinc finger protein 528. |
HUGO Gene Name : | zinc finger protein 528 (ZNF528) |
Clone Name : | fk01409 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3072 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1662 bp Genome contig ID gi42406306f_57510411 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TCTCATGTTTGTAGTAATAAAGTTTCATTTTTCCTFlanking genome sequence
(103055 - 103104) ----+----*----+----*----+----*----+----*----+----*
AAGTATGAATGAATCGTGTTTTCTACCGTCATAATTTCATCCCACCTCAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 57610411 57613464 1 99.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 469 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 54 | 77 | PD000003 | Zinc finger |
IPR007087 | 82 | 105 | PD000003 | Zinc finger | |
IPR007087 | 110 | 133 | PD000003 | Zinc finger | |
IPR007087 | 138 | 161 | PD000003 | Zinc finger | |
IPR007087 | 166 | 189 | PD000003 | Zinc finger | |
IPR007087 | 194 | 217 | PD000003 | Zinc finger | |
IPR007087 | 222 | 245 | PD000003 | Zinc finger | |
IPR007087 | 250 | 273 | PD000003 | Zinc finger | |
IPR007087 | 306 | 329 | PD000003 | Zinc finger | |
IPR007087 | 334 | 357 | PD000003 | Zinc finger | |
IPR007087 | 362 | 385 | PD000003 | Zinc finger | |
IPR007087 | 390 | 413 | PD000003 | Zinc finger | |
IPR007087 | 418 | 440 | PD000003 | Zinc finger | |
IPR007087 | 446 | 469 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 54 | 76 | PF00096 | Zinc finger |
IPR007087 | 82 | 104 | PF00096 | Zinc finger | |
IPR007087 | 110 | 132 | PF00096 | Zinc finger | |
IPR007087 | 138 | 160 | PF00096 | Zinc finger | |
IPR007087 | 166 | 188 | PF00096 | Zinc finger | |
IPR007087 | 194 | 216 | PF00096 | Zinc finger | |
IPR007087 | 222 | 244 | PF00096 | Zinc finger | |
IPR007087 | 250 | 272 | PF00096 | Zinc finger | |
IPR007087 | 278 | 300 | PF00096 | Zinc finger | |
IPR007087 | 306 | 328 | PF00096 | Zinc finger | |
IPR007087 | 334 | 356 | PF00096 | Zinc finger | |
IPR007087 | 362 | 384 | PF00096 | Zinc finger | |
IPR007087 | 390 | 412 | PF00096 | Zinc finger | |
IPR007087 | 418 | 440 | PF00096 | Zinc finger | |
IPR007087 | 446 | 468 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 54 | 76 | SM00355 | Zinc finger |
IPR015880 | 82 | 104 | SM00355 | Zinc finger | |
IPR015880 | 110 | 132 | SM00355 | Zinc finger | |
IPR015880 | 138 | 160 | SM00355 | Zinc finger | |
IPR015880 | 166 | 188 | SM00355 | Zinc finger | |
IPR015880 | 194 | 216 | SM00355 | Zinc finger | |
IPR015880 | 222 | 244 | SM00355 | Zinc finger | |
IPR015880 | 250 | 272 | SM00355 | Zinc finger | |
IPR015880 | 278 | 300 | SM00355 | Zinc finger | |
IPR015880 | 306 | 328 | SM00355 | Zinc finger | |
IPR015880 | 334 | 356 | SM00355 | Zinc finger | |
IPR015880 | 362 | 384 | SM00355 | Zinc finger | |
IPR015880 | 390 | 412 | SM00355 | Zinc finger | |
IPR015880 | 418 | 440 | SM00355 | Zinc finger | |
IPR015880 | 446 | 468 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 54 | 81 | PS50157 | Zinc finger |
IPR007087 | 82 | 109 | PS50157 | Zinc finger | |
IPR007087 | 110 | 137 | PS50157 | Zinc finger | |
IPR007087 | 138 | 165 | PS50157 | Zinc finger | |
IPR007087 | 166 | 193 | PS50157 | Zinc finger | |
IPR007087 | 194 | 221 | PS50157 | Zinc finger | |
IPR007087 | 222 | 249 | PS50157 | Zinc finger | |
IPR007087 | 250 | 277 | PS50157 | Zinc finger | |
IPR007087 | 278 | 305 | PS50157 | Zinc finger | |
IPR007087 | 306 | 333 | PS50157 | Zinc finger | |
IPR007087 | 334 | 361 | PS50157 | Zinc finger | |
IPR007087 | 362 | 389 | PS50157 | Zinc finger | |
IPR007087 | 390 | 417 | PS50157 | Zinc finger | |
IPR007087 | 418 | 445 | PS50157 | Zinc finger | |
IPR007087 | 446 | 469 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 56 | 76 | PS00028 | Zinc finger |
IPR007087 | 84 | 104 | PS00028 | Zinc finger | |
IPR007087 | 112 | 132 | PS00028 | Zinc finger | |
IPR007087 | 140 | 160 | PS00028 | Zinc finger | |
IPR007087 | 168 | 188 | PS00028 | Zinc finger | |
IPR007087 | 196 | 216 | PS00028 | Zinc finger | |
IPR007087 | 224 | 244 | PS00028 | Zinc finger | |
IPR007087 | 252 | 272 | PS00028 | Zinc finger | |
IPR007087 | 280 | 300 | PS00028 | Zinc finger | |
IPR007087 | 308 | 328 | PS00028 | Zinc finger | |
IPR007087 | 336 | 356 | PS00028 | Zinc finger | |
IPR007087 | 364 | 384 | PS00028 | Zinc finger | |
IPR007087 | 392 | 412 | PS00028 | Zinc finger | |
IPR007087 | 420 | 440 | PS00028 | Zinc finger | |
IPR007087 | 448 | 468 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGATTTAGAGAGCATGGAGG | |
: CCTATGCCTTAAGATTACAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |