HUGE

Gene/Protein Characteristic Table for KIAA1831

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00929
Accession No. :	AB058734
Description :	Junctophilin-4.
HUGO Gene Name :	junctophilin 4 (JPH4)
Clone Name :	hk00543 [Vector Info]
Flexi ORF Clone :	pF1KSDA1831
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4278 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1599 bp

Genome contig ID gi51511730r_23007144
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAAAAAATATATTAATAAAAAAGTTCAAAAAAGGG
Flanking genome sequence
(99940 - 99891)
----+----*----+----*----+----*----+----*----+----*
GGGGGATTGTCATCTCCTTTGGGGTGCGATGGCTTCAAATCCAAACTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 23107084 23117849 6 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JJ6	3.9e-204	100.0	Junctophilin-4;...	Homo sapiens
BAF83200	9.5e-204	99.7	unnamed protein...	Homo sapiens
AAH55429	2.9e-203	99.7	Junctophilin 4 ...	Homo sapiens
XP_001109175	7.2e-203	99.4	junctophilin 4 ...	Macaca mulatta
EDM14220	3e-196	96.3	rCG23591 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003409 50 72 PF02493 MORN motif

IPR003409 74 95 PF02493 MORN motif

IPR003409 96 117 PF02493 MORN motif

IPR003409 118 140 PF02493 MORN motif

IPR003409 141 163 PF02493 MORN motif

IPR003409 164 186 PF02493 MORN motif

IPR003409 317 339 PF02493 MORN motif

IPR003409 340 362 PF02493 MORN motif

HMMSmart IPR003409 48 69 SM00698 MORN motif

IPR003409 94 115 SM00698 MORN motif

IPR003409 139 160 SM00698 MORN motif

IPR003409 162 183 SM00698 MORN motif

IPR003409 315 336 SM00698 MORN motif

IPR003409 338 359 SM00698 MORN motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003409	50	72	PF02493	MORN motif
IPR003409	74	95	PF02493	MORN motif
IPR003409	96	117	PF02493	MORN motif
IPR003409	118	140	PF02493	MORN motif
IPR003409	141	163	PF02493	MORN motif
IPR003409	164	186	PF02493	MORN motif
IPR003409	317	339	PF02493	MORN motif
IPR003409	340	362	PF02493	MORN motif
HMMSmart	IPR003409	48	69	SM00698	MORN motif
IPR003409	94	115	SM00698	MORN motif
IPR003409	139	160	SM00698	MORN motif
IPR003409	162	183	SM00698	MORN motif
IPR003409	315	336	SM00698	MORN motif
IPR003409	338	359	SM00698	MORN motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 639 ANPLVVGAVALLDLSLAFLFSQL 661 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	639	ANPLVVGAVALLDLSLAFLFSQL	661	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGGACCAGACAAGATAACAG

Primer_r
: TTTGATCCCCTCCTTCTGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1599 bp
Genome contig ID	gi51511730r_23007144
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAAAAATATATTAATAAAAAAGTTCAAAAAAGGG
Flanking genome sequence (99940 - 99891)	----+--------+--------+--------+--------+----* GGGGGATTGTCATCTCCTTTGGGGTGCGATGGCTTCAAATCCAAACTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	23107084	23117849	6	100.0	Perfect prediction

Primer_f	: TAGGACCAGACAAGATAACAG
Primer_r	: TTTGATCCCCTCCTTCTGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1831

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information