HUGE

Gene/Protein Characteristic Table for KIAA1848

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00931
Accession No. :	AB058751
Description :	SH3 domain GRB2-like protein B2.
HUGO Gene Name :	SH3-domain GRB2-like endophilin B2 (SH3GLB2)
Clone Name :	bm03548 [Vector Info]
Flexi ORF Clone :	pF1KSDA1848
Source :	Human adult brain
Note :	We replaced hh13792, former representative clones for KIAA1848 with bm03548. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 1985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 645 bp

Genome contig ID gi89161216r_130710139
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTGCTCTCTAGCCAATAAACCGTCCTTGTGTGCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCACCTGGGCTCCTGTCAGGGCCTGGCCCTGAGGGTGGTAAAGGGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 130810139 130830379 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI12365	2e-147	100.0	SH3-domain GRB2...	Homo sapiens
CAX15002	2.9e-144	99.0	SH3-domain GRB2...	Homo sapiens
CAM23165	1.3e-143	97.0	SH3-domain GRB2...	Mus musculus
Q5PPJ9	7.8e-143	96.3	Endophilin-B2; ...	Rattus norvegicus
XP_850321	4.1e-142	97.0	similar to SH3 ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007960	6.3e-37	58.3	KIAA0491

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 389 442 PD000066 Src homology-3

FPrintScan IPR001452 388 398 PR00452 Src homology-3

IPR001452 402 417 PR00452 Src homology-3

IPR001452 432 444 PR00452 Src homology-3

HMMPfam IPR004148 49 325 PF03114 BAR

IPR001452 388 444 PF00018 Src homology-3

HMMSmart IPR004148 48 325 SM00721 BAR

IPR001452 388 445 SM00326 Src homology-3

ProfileScan IPR004148 65 332 PS51021 BAR

IPR001452 385 445 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	389	442	PD000066	Src homology-3
FPrintScan	IPR001452	388	398	PR00452	Src homology-3
IPR001452	402	417	PR00452	Src homology-3
IPR001452	432	444	PR00452	Src homology-3
HMMPfam	IPR004148	49	325	PF03114	BAR
IPR001452	388	444	PF00018	Src homology-3
HMMSmart	IPR004148	48	325	SM00721	BAR
IPR001452	388	445	SM00326	Src homology-3
ProfileScan	IPR004148	65	332	PS51021	BAR
IPR001452	385	445	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCGGGTGCTCTATGACTACG

Primer_r
: GCAGTTCCAAGTAGGTGACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: CCR
Primer_f	: AGACTGAGCTTGATGCCCACT
Primer_r	: TTCCTGTCCAGCTTCTCATAC
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec154(1.2k) cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	645 bp
Genome contig ID	gi89161216r_130710139
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTGCTCTCTAGCCAATAAACCGTCCTTGTGTGCG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCACCTGGGCTCCTGTCAGGGCCTGGCCCTGAGGGTGGTAAAGGGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	130810139	130830379	11	99.2	Perfect prediction

Primer_f	: CTCGGGTGCTCTATGACTACG
Primer_r	: GCAGTTCCAAGTAGGTGACAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1848

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information