HUGE

Gene/Protein Characteristic Table for KIAA1849

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB058752
Description :
HUGO Gene Name :
Clone Name :	fg05386 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5957 bp
Physical map
Restriction map
The revised DNA sequence was revised to adapt it for the corresponding genomic sequence without any experiments following the alert of coding interruption by GeneMark analysis, because this interruption seemed to be caused by an error of the reverse transcriptase.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2611 bp

Genome contig ID gi89161213r_4703212
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTCGCGGACCCTCGCGGTGAGTGTTACAGTTCTT
Flanking genome sequence
(97599 - 97550)
----+----*----+----*----+----*----+----*----+----*
AAAGGCTGCGTGTCCGCAGTTTGTTCTTTATGATGTTCGGATGTGTTCGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 4800811 4889811 16 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1114 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAL23966	99.8	hypothetical pr...	Homo sapiens
ABQ59033	98.6	FLJ10324 protei...	Homo sapiens
Q96JH8	98.4	Ras-associating...	Homo sapiens
NP_060529	98.3	Rap GTPase inte...	Homo sapiens
EDL89709	79.5	rCG42648, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002710 659 743 PD003376 Dilute

HMMPfam IPR000159 102 205 PF00788 Ras-association

IPR000253 320 387 PF00498 Forkhead-associated

IPR002710 674 783 PF01843 Dilute

IPR001478 1015 1097 PF00595 PDZ/DHR/GLGF

HMMSmart IPR000159 102 205 SM00314 Ras-association

IPR001478 1023 1100 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000159 102 205 PS50200 Ras-association

IPR002710 536 803 PS51126 Dilute

IPR001478 1015 1100 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002710	659	743	PD003376	Dilute
HMMPfam	IPR000159	102	205	PF00788	Ras-association
IPR000253	320	387	PF00498	Forkhead-associated
IPR002710	674	783	PF01843	Dilute
IPR001478	1015	1097	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR000159	102	205	SM00314	Ras-association
IPR001478	1023	1100	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000159	102	205	PS50200	Ras-association
IPR002710	536	803	PS51126	Dilute
IPR001478	1015	1100	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATCACAGGCTCGAAGGAATC

Primer_r
: CAGATGTACAGGGACTTGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATCCTCAGCAGCTCCACCAAC
Primer_r	: TGTCCCAGTGAGAGGTGCATC
PCR product length	: 95 bp
PCR conditions	: 15 °C66 sec60 °C30 sec153 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	2611 bp
Genome contig ID	gi89161213r_4703212
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCGCGGACCCTCGCGGTGAGTGTTACAGTTCTT
Flanking genome sequence (97599 - 97550)	----+--------+--------+--------+--------+----* AAAGGCTGCGTGTCCGCAGTTTGTTCTTTATGATGTTCGGATGTGTTCGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	4800811	4889811	16	99.8	Perfect prediction

Primer_f	: CATCACAGGCTCGAAGGAATC
Primer_r	: CAGATGTACAGGGACTTGGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1849

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information