HUGE |
Gene/Protein Characteristic Table for KIAA1849 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB058752 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fg05386 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5957 bp
The revised DNA sequence was revised to adapt it for the corresponding genomic sequence without any experiments following the alert of coding interruption by GeneMark analysis, because this interruption seemed to be caused by an error of the reverse transcriptase.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 2611 bp Genome contig ID gi89161213r_4703212 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGTCGCGGACCCTCGCGGTGAGTGTTACAGTTCTTFlanking genome sequence
(97599 - 97550) ----+----*----+----*----+----*----+----*----+----*
AAAGGCTGCGTGTCCGCAGTTTGTTCTTTATGATGTTCGGATGTGTTCGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 4800811 4889811 16 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1114 aa
This protein sequence is predicted from the revised DNA sequence
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATCACAGGCTCGAAGGAATC | |
: CAGATGTACAGGGACTTGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: ATCCTCAGCAGCTCCACCAAC | |
: TGTCCCAGTGAGAGGTGCATC | |
: 95 bp | |
: 15 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |