HUGE

Gene/Protein Characteristic Table for KIAA1850

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB058753
Description :	Deubiquitinating protein VCIP135.
HUGO Gene Name :	valosin containing protein (p97)/p47 complex interacting protein 1 (VCPIP1)
Clone Name :	pf00747 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 7190 bp
Physical map
Restriction map
The revised DNA sequence was revised to adapt it for the corresponding genomic sequence without any experiments following the alert of coding interruption by GeneMark analysis, because this interruption seemed to be caused by an error of the reverse transcriptase.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 3261 bp

Genome contig ID gi51511724r_67606029
PolyA signal sequence
(CATAAA,-22)
+----*----+----*----+----*----+----
AATATAGTGGCAGCATAAAGTGTTTATTTCAGAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCAATACAGTTTTGTCTTCATTTTTCAACAGTAATTTCAATTGGTTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 67706029 67742006 3 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1236 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JH7	100.0	Deubiquitinatin...	Homo sapiens
CAD89944	99.8	hypothetical pr...	Homo sapiens
XP_001161197	99.8	valosin contain...	Pan troglodytes
CAL38641	99.8	hypothetical pr...	synthetic construct
XP_001095794	99.8	similar to valo...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003323 228 369 PF02338 Ovarian tumour

ProfileScan IPR003323 222 375 PS50802 Ovarian tumour

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003323	228	369	PF02338	Ovarian tumour
ProfileScan	IPR003323	222	375	PS50802	Ovarian tumour

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTCTGGAGGACATTAAGCG

Primer_r
: TGGAACAGAGCTTGATATCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: CCR
Primer_f	: CACTCTGGAGGACATTAAGCG
Primer_r	: TGGAACAGAGCTTGATATCGG
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec195 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	3261 bp
Genome contig ID	gi51511724r_67606029
PolyA signal sequence (CATAAA,-22)	+--------+--------+----*----+---- AATATAGTGGCAGCATAAAGTGTTTATTTCAGAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAATACAGTTTTGTCTTCATTTTTCAACAGTAATTTCAATTGGTTCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	67706029	67742006	3	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1850

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information