HUGE

Gene/Protein Characteristic Table for KIAA1859

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00934
Accession No. :	AB058762
Description :
HUGO Gene Name :	melanoma antigen family D, 4 (MAGED4)
Clone Name :	bm01165 [Vector Info]
Flexi ORF Clone :	pF1KSDA1859
Source :	Human adult brain
Note :	We replaced fh15135, former representative clones for KIAA1859 with bm01165. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 200 bp

Genome contig ID gi89161218f_51844683
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TTTGGGTATCAGTGTTACATTAAAGTTGCAAAATT
Flanking genome sequence
(107421 - 107470)
----+----*----+----*----+----*----+----*----+----*
AATTTGGATGTTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCA

Features of the protein sequence	Description

Length: 761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JG8	100.0	Melanoma-associ...	Homo sapiens
BAF82147	99.9	unnamed protein...	Homo sapiens
XP_001085892	97.0	similar to mela...	Macaca mulatta
BAB33379	100.0	MAGE-E1b [Homo ...	Homo sapiens
XP_001497708	91.3	melanoma antige...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029037	1.6e-36	41.5	KIAA1114
AB046807	2.7e-15	26.2	KIAA1587

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002190 440 609 PF01454 MAGE protein

ProfileScan IPR002190 433 631 PS50838 MAGE protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002190	440	609	PF01454	MAGE protein
ProfileScan	IPR002190	433	631	PS50838	MAGE protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCGATTTCACTCAGCCGG

Primer_r
: CTGCTGCCACAACATTCTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	200 bp
Genome contig ID	gi89161218f_51844683
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TTTGGGTATCAGTGTTACATTAAAGTTGCAAAATT
Flanking genome sequence (107421 - 107470)	----+--------+--------+--------+--------+----* AATTTGGATGTTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCA

Primer_f	: TCTTCGATTTCACTCAGCCGG
Primer_r	: CTGCTGCCACAACATTCTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1859

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information