HUGE |
Gene/Protein Characteristic Table for KIAA1859 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00934 |
---|---|
Accession No. : | AB058762 |
Description : | |
HUGO Gene Name : | melanoma antigen family D, 4 (MAGED4) |
Clone Name : | bm01165 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1859 |
Source : | Human adult brain |
Note : | We replaced fh15135, former representative clones for KIAA1859 with bm01165. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2576 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 200 bp Genome contig ID gi89161218f_51844683 PolyA signal sequence
(ATTAAA,-17) +----*----+----*----+----*----+----
TTTGGGTATCAGTGTTACATTAAAGTTGCAAAATTFlanking genome sequence
(107421 - 107470) ----+----*----+----*----+----*----+----*----+----*
AATTTGGATGTTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCA
Features of the protein sequence |
Description | |
---|---|---|
Length: 761 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTTCGATTTCACTCAGCCGG | |
: CTGCTGCCACAACATTCTGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: X |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |