HUGE

Gene/Protein Characteristic Table for KIAA1587

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00872
Accession No. :	AB046807
Description :	Melanoma-associated antigen E1.
HUGO Gene Name :	melanoma antigen family E, 1 (MAGEE1)
Clone Name :	fj08327 [Vector Info]
Flexi ORF Clone :	pF1KSDA1587
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3628 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 547 bp

Genome contig ID gi89161218f_75464521
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GAAAAATAAAAGATTAATAAATGAAACATAATGCT
Flanking genome sequence
(103629 - 103678)
----+----*----+----*----+----*----+----*----+----*
AATACACTGACTTATTCAACTGCTTTCATACAGTGAGCACAGTGGTGTGC

Features of the protein sequence	Description

Length: 991 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCI5	0	100.0	Melanoma-associ...	Homo sapiens
AAH50588	0	99.9	Melanoma antige...	Homo sapiens
Q9BE18	0	93.2	Melanoma-associ...	Macaca fascicularis
XP_001098743	6.3e-215	94.8	similar to mela...	Macaca mulatta
XP_001143922	1.1e-194	93.9	melanoma antige...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029037	1.9e-08	25.7	KIAA1114
AB058762	2.4e-08	26.1	KIAA1859

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 198 324 PD041608 NULL

IPR008165 325 423 PD003992 Protein of unknown function GLTT

NULL 424 471 PD041608 NULL

HMMPfam IPR002190 532 702 PF01454 MAGE protein

IPR002190 786 948 PF01454 MAGE protein

ProfileScan IPR002190 525 724 PS50838 MAGE protein

IPR002190 779 970 PS50838 MAGE protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	198	324	PD041608	NULL
IPR008165	325	423	PD003992	Protein of unknown function GLTT
NULL	424	471	PD041608	NULL
HMMPfam	IPR002190	532	702	PF01454	MAGE protein
IPR002190	786	948	PF01454	MAGE protein
ProfileScan	IPR002190	525	724	PS50838	MAGE protein
IPR002190	779	970	PS50838	MAGE protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTTACGGGTTCCTGACAGTG

Primer_r
: AACATCAGCTCTATTGGCCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	547 bp
Genome contig ID	gi89161218f_75464521
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GAAAAATAAAAGATTAATAAATGAAACATAATGCT
Flanking genome sequence (103629 - 103678)	----+--------+--------+--------+--------+----* AATACACTGACTTATTCAACTGCTTTCATACAGTGAGCACAGTGGTGTGC

Primer_f	: GTTTACGGGTTCCTGACAGTG
Primer_r	: AACATCAGCTCTATTGGCCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1587

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information