HUGE

Gene/Protein Characteristic Table for KIAA1870

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04604
Accession No. :	AB058773
Description :	collagen, type XXVII, alpha 1.
HUGO Gene Name :	collagen, type XXVII, alpha 1 (COL27A1)
Clone Name :	hh05136b [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 856 bp

Genome contig ID gi89161216f_115870709
PolyA signal sequence
(AAGAAA,-11)
+----*----+----*----+----*----+----
AATCTGCTAAGGAGGAAAAAAGAAAAGAAAAAAGG
Flanking genome sequence
(242942 - 242991)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGCAAAACAAAAACAAAAACAAAAACCCTACCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 115970709 116113649 57 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZC6	100.0	Collagen alpha-...	Homo sapiens
EAW87414	99.3	collagen, type ...	Homo sapiens
EAW87412	99.3	collagen, type ...	Homo sapiens
XP_520208	96.6	collagen, type ...	Pan troglodytes
XP_602219	93.9	collagen, type ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040943	9.7e-07	40.6	KIAA1510
AB020631	1.1e-06	33.2	KIAA0824

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR008161 149 185 PD000007 Collagen helix repeat

IPR008161 266 285 PD000007 Collagen helix repeat

IPR008161 393 419 PD000007 Collagen helix repeat

IPR008161 445 475 PD000007 Collagen helix repeat

IPR008161 498 537 PD000007 Collagen helix repeat

IPR000885 721 832 PD002078 Fibrillar collagen

HMMPfam IPR008160 59 118 PF01391 Collagen triple helix repeat

IPR008160 131 190 PF01391 Collagen triple helix repeat

IPR008160 191 250 PF01391 Collagen triple helix repeat

IPR008160 251 310 PF01391 Collagen triple helix repeat

IPR008160 312 371 PF01391 Collagen triple helix repeat

IPR008160 384 443 PF01391 Collagen triple helix repeat

IPR008160 450 509 PF01391 Collagen triple helix repeat

IPR008160 534 593 PF01391 Collagen triple helix repeat

IPR000885 648 831 PF01410 Fibrillar collagen

HMMSmart IPR000885 631 832 SM00038 Fibrillar collagen

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	149	185	PD000007	Collagen helix repeat
IPR008161	266	285	PD000007	Collagen helix repeat
IPR008161	393	419	PD000007	Collagen helix repeat
IPR008161	445	475	PD000007	Collagen helix repeat
IPR008161	498	537	PD000007	Collagen helix repeat
IPR000885	721	832	PD002078	Fibrillar collagen
HMMPfam	IPR008160	59	118	PF01391	Collagen triple helix repeat
IPR008160	131	190	PF01391	Collagen triple helix repeat
IPR008160	191	250	PF01391	Collagen triple helix repeat
IPR008160	251	310	PF01391	Collagen triple helix repeat
IPR008160	312	371	PF01391	Collagen triple helix repeat
IPR008160	384	443	PF01391	Collagen triple helix repeat
IPR008160	450	509	PF01391	Collagen triple helix repeat
IPR008160	534	593	PF01391	Collagen triple helix repeat
IPR000885	648	831	PF01410	Fibrillar collagen
HMMSmart	IPR000885	631	832	SM00038	Fibrillar collagen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACACTACCTCAGCAACCTC

Primer_r
: ATGAGTGAAGTTGCAGGAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	856 bp
Genome contig ID	gi89161216f_115870709
PolyA signal sequence (AAGAAA,-11)	+--------+--------+----*----+---- AATCTGCTAAGGAGGAAAAAAGAAAAGAAAAAAGG
Flanking genome sequence (242942 - 242991)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGCAAAACAAAAACAAAAACAAAAACCCTACCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	115970709	116113649	57	99.6	Perfect prediction

Primer_f	: TTACACTACCTCAGCAACCTC
Primer_r	: ATGAGTGAAGTTGCAGGAGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1870

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information