HUGE

Gene/Protein Characteristic Table for KIAA1878

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05926
Accession No. :	AB058781
Description :	microtubule-associated protein 6 isoform 1.
HUGO Gene Name :	microtubule-associated protein 6 (MAP6)
Clone Name :	pj01649 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4328 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2943 bp

Genome contig ID gi51511727r_74891554
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTCCAATTATAAATAAATGCTAAAGACGAACACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTCTTGATCTTATTTCCTTGGTGAGGCCCACCTGAGTAGGTGAAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 74991554 75057127 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI50255	1e-124	100.0	Microtubule-ass...	Homo sapiens
NP_997460	1.7e-124	99.8	microtubule-ass...	Homo sapiens
Q96JE9	2.5e-124	99.8	Microtubule-ass...	Homo sapiens
XP_001175009	6.4e-123	98.9	microtubule-ass...	Pan troglodytes
XP_508647	9.7e-123	98.9	microtubule-ass...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007882 15 453 PF05217 STOP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007882	15	453	PF05217	STOP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCACCCAAGGCTTTAGAGGAC

Primer_r
: GGGATATAGAATGAGACTGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: CCR
Primer_f	: TCACCCAAGGCTTTAGAGGAC
Primer_r	: GGGATATAGAATGAGACTGGC
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec193 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2943 bp
Genome contig ID	gi51511727r_74891554
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTCCAATTATAAATAAATGCTAAAGACGAACACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTCTTGATCTTATTTCCTTGGTGAGGCCCACCTGAGTAGGTGAAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	74991554	75057127	3	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1878

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information