HUGE

Gene/Protein Characteristic Table for KIAA1898

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07009
Accession No. :	AB067485
Description :	LKB1 interacting protein.
HUGO Gene Name :	serine/threonine kinase 11 interacting protein (STK11IP)
Clone Name :	fk06427 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3299 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 255 bp

Genome contig ID gi89161199f_220074363
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTTTCTCAGGTATCAATAAAGTTGTTTCCAACTC
Flanking genome sequence
(115053 - 115102)
----+----*----+----*----+----*----+----*----+----*
ATAGGTCATGTGTGGTACTTAGAGTCACTCATAAGGCCTGCAGTTCCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 220174363 220189414 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N1F8	100.0	Serine/threonin...	Homo sapiens
AAL49726	99.9	LKB1-interactin...	Homo sapiens
NP_443134	99.9	LKB1 interactin...	Homo sapiens
AAH34051	99.6	Serine/threonin...	Homo sapiens
XP_001105761	94.4	similar to LKB1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023192	0.0001	26.9	KIAA0975

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 136 149 PR00019 Leucine-rich repeat

IPR001611 178 191 PR00019 Leucine-rich repeat

HMMPfam IPR001611 180 203 PF00560 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	136	149	PR00019	Leucine-rich repeat
IPR001611	178	191	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	180	203	PF00560	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTCCTTGATGTCTTGCAGTC

Primer_r
: AAGGTAGAAGAACTGGCGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	255 bp
Genome contig ID	gi89161199f_220074363
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTCTCAGGTATCAATAAAGTTGTTTCCAACTC
Flanking genome sequence (115053 - 115102)	----+--------+--------+--------+--------+----* ATAGGTCATGTGTGGTACTTAGAGTCACTCATAAGGCCTGCAGTTCCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	220174363	220189414	23	99.9	Perfect prediction

Primer_f	: GCTCCTTGATGTCTTGCAGTC
Primer_r	: AAGGTAGAAGAACTGGCGAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1898

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information