HUGE

Gene/Protein Characteristic Table for KIAA0975

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01618
Accession No. :	AB023192
Description :	nischarin.
HUGO Gene Name :	nischarin (NISCH)
Clone Name :	hj06890 [Vector Info]
Flexi ORF Clone :	pF1KSDA0975
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5161 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 574 bp

Genome contig ID gi89161205f_52364661
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTCTCTATTCCAATAAAGCAGAGTTTGACACCGTC
Flanking genome sequence
(137465 - 137514)
----+----*----+----*----+----*----+----*----+----*
TGCATCTTCTAAACCAAGGGTCACTGGGATCCCAGCAGGGCTTCCGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 52464174 52502124 22 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09925	100.0	nischarin [synt...	synthetic construct
AAC33104	99.9	I-1 receptor ca...	Homo sapiens
AAH56900	99.9	Nischarin [Homo...	Homo sapiens
Q9Y2I1	99.9	Nischarin; Imid...	Homo sapiens
AAH38102	99.9	Nischarin [Homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067485	0.00016	26.8	KIAA1898

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 313 326 PR00019 Leucine-rich repeat

IPR001611 355 368 PR00019 Leucine-rich repeat

HMMPfam IPR001683 38 142 PF00787 Phox-like

IPR001611 312 333 PF00560 Leucine-rich repeat

IPR001611 335 355 PF00560 Leucine-rich repeat

IPR001611 357 377 PF00560 Leucine-rich repeat

IPR001611 380 400 PF00560 Leucine-rich repeat

IPR001611 402 422 PF00560 Leucine-rich repeat

HMMSmart IPR001683 38 142 SM00312 Phox-like

NULL 310 328 SM00365 NULL

IPR003591 310 332 SM00369 Leucine-rich repeat

NULL 333 354 SM00365 NULL

NULL 355 376 SM00365 NULL

IPR003591 355 377 SM00369 Leucine-rich repeat

NULL 378 399 SM00365 NULL

IPR003591 378 399 SM00369 Leucine-rich repeat

NULL 400 421 SM00365 NULL

IPR003591 400 425 SM00369 Leucine-rich repeat

ProfileScan IPR001683 35 145 PS50195 Phox-like

ScanRegExp IPR001128 827 836 PS00086 Cytochrome P450

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	313	326	PR00019	Leucine-rich repeat
IPR001611	355	368	PR00019	Leucine-rich repeat
HMMPfam	IPR001683	38	142	PF00787	Phox-like
IPR001611	312	333	PF00560	Leucine-rich repeat
IPR001611	335	355	PF00560	Leucine-rich repeat
IPR001611	357	377	PF00560	Leucine-rich repeat
IPR001611	380	400	PF00560	Leucine-rich repeat
IPR001611	402	422	PF00560	Leucine-rich repeat
HMMSmart	IPR001683	38	142	SM00312	Phox-like
NULL	310	328	SM00365	NULL
IPR003591	310	332	SM00369	Leucine-rich repeat
NULL	333	354	SM00365	NULL
NULL	355	376	SM00365	NULL
IPR003591	355	377	SM00369	Leucine-rich repeat
NULL	378	399	SM00365	NULL
IPR003591	378	399	SM00369	Leucine-rich repeat
NULL	400	421	SM00365	NULL
IPR003591	400	425	SM00369	Leucine-rich repeat
ProfileScan	IPR001683	35	145	PS50195	Phox-like
ScanRegExp	IPR001128	827	836	PS00086	Cytochrome P450

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTTAATTTGACTGTCCTCGC

Primer_r
: TAACAACGGTCCCACAACAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	574 bp
Genome contig ID	gi89161205f_52364661
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCTCTATTCCAATAAAGCAGAGTTTGACACCGTC
Flanking genome sequence (137465 - 137514)	----+--------+--------+--------+--------+----* TGCATCTTCTAAACCAAGGGTCACTGGGATCCCAGCAGGGCTTCCGTCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	52464174	52502124	22	99.1	Perfect prediction

Primer_f	: CCTTAATTTGACTGTCCTCGC
Primer_r	: TAACAACGGTCCCACAACAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0975

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information