HUGE

Gene/Protein Characteristic Table for KIAA1983

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB075863
Description :	Collagen and calcium-binding EGF domain-containing protein 1 precursor.
HUGO Gene Name :	collagen and calcium binding EGF domains 1 (CCBE1)
Clone Name :	fk09737 [Vector Info]
Flexi ORF Clone :	pF1KA1983
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3363 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1991 bp

Genome contig ID gi51511735r_55152400
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCAGCCTAGGCAACAGAGGGAGACTCTGTCTCATT
Flanking genome sequence
(99729 - 99680)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAGGCCGGGCTTGGTGGCTCATGCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 r 55252129 55515592 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 418 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_512156	7.7e-137	99.5	collagen and ca...	Pan troglodytes
XP_001090495	1e-135	98.3	similar to coll...	Macaca mulatta
Q6UXH8	6.8e-134	100.0	Collagen and ca...	Homo sapiens
EDL09670	4.4e-123	89.2	collagen and ca...	Mus musculus
EDL09671	4.4e-123	89.2	collagen and ca...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013091 146 186 PF07645 EGF calcium-binding

IPR008160 257 302 PF01391 Collagen triple helix repeat

IPR008160 312 345 PF01391 Collagen triple helix repeat

HMMSmart IPR001881 101 145 SM00179 EGF-like calcium-binding

IPR006210 104 145 SM00181 EGF

IPR001881 146 187 SM00179 EGF-like calcium-binding

IPR006210 149 187 SM00181 EGF

ProfileScan IPR000742 146 187 PS50026 EGF-like

ScanRegExp IPR001881 146 171 PS01187 EGF-like calcium-binding

IPR000152 162 173 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 171 186 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013091	146	186	PF07645	EGF calcium-binding
IPR008160	257	302	PF01391	Collagen triple helix repeat
IPR008160	312	345	PF01391	Collagen triple helix repeat
HMMSmart	IPR001881	101	145	SM00179	EGF-like calcium-binding
IPR006210	104	145	SM00181	EGF
IPR001881	146	187	SM00179	EGF-like calcium-binding
IPR006210	149	187	SM00181	EGF
ProfileScan	IPR000742	146	187	PS50026	EGF-like
ScanRegExp	IPR001881	146	171	PS01187	EGF-like calcium-binding
IPR000152	162	173	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	171	186	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGCAATGACATCACTGAGCTG

Primer_r
: ACGGTGTTGGGATGTGCTATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1991 bp
Genome contig ID	gi51511735r_55152400
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAGCCTAGGCAACAGAGGGAGACTCTGTCTCATT
Flanking genome sequence (99729 - 99680)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAGGCCGGGCTTGGTGGCTCATGCCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	r	55252129	55515592	11	100.0	Perfect prediction

Primer_f	: CGCAATGACATCACTGAGCTG
Primer_r	: ACGGTGTTGGGATGTGCTATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1983

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information