HUGE

Gene/Protein Characteristic Table for KIAA2010

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00308
Accession No. :	AB095930
Description :	SMEK homolog 1, suppressor of mek1.
HUGO Gene Name :
Clone Name :	fj14762 [Vector Info]
Flexi ORF Clone :	pF1KA2010
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4106 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1146 bp

Genome contig ID gi51511730r_90893711
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TTTTTAATAATAAAAAGAAAAGTGAAGAGTAAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGTATTAGTTGTATGTTTCTTGTTTTTGTTTTTAACTACTCCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 90993711 91046241 15 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001140788	100.0	hypothetical pr...	Pan troglodytes
XP_001928870	99.4	SMEK homolog 1,...	Sus scrofa
XP_854423	99.4	similar to CG93...	Canis lupus fam...
Q6P2K6	99.3	Serine/threonin...	Mus musculus
XP_001790690	98.8	SMEK homolog 1,...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037808	2.9e-98	71.8	KIAA1387

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006887 264 457 PF04802 Protein of unknown function DUF625

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006887	264	457	PF04802	Protein of unknown function DUF625

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCTCTTACACTTGACTTCTG

Primer_r
: TTCCACTTACAAAACCCCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1146 bp
Genome contig ID	gi51511730r_90893711
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTTTTAATAATAAAAAGAAAAGTGAAGAGTAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTGTATTAGTTGTATGTTTCTTGTTTTTGTTTTTAACTACTCCCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	90993711	91046241	15	99.7	Perfect prediction

Primer_f	: GCCTCTTACACTTGACTTCTG
Primer_r	: TTCCACTTACAAAACCCCTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2010

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information