HUGE

Gene/Protein Characteristic Table for KIAA1387

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00820
Accession No. :	AB037808
Description :	SMEK homolog 2.
HUGO Gene Name :	SMEK homolog 2, suppressor of mek1 (Dictyostelium) (SMEK2)
Clone Name :	fj06480 [Vector Info]
Flexi ORF Clone :	pF1KSDA1387
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4385 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1532 bp

Genome contig ID gi89161199r_55529019
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
AAAATTCAGGAATTAAAATGTGACCCTGTAATTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAATTGATGTTTGTGTTTGGTTTGTTGTAAATATAAATTAACTCCATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 55629019 55698227 17 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001116436	0	99.9	SMEK homolog 2,...	Homo sapiens
XP_001112386	0	91.8	similar to fala...	Macaca mulatta
BAG59121	0	99.4	unnamed protein...	Homo sapiens
XP_531833	2e-211	92.6	similar to CG93...	Canis lupus fam...
XP_001496215	4.4e-186	87.5	SMEK homolog 2,...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095930	4.1e-140	71.8	KIAA2010

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006887 267 460 PF04802 Protein of unknown function DUF625

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006887	267	460	PF04802	Protein of unknown function DUF625

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGTCAACCGCCTACCAGTAC

Primer_r
: GCACTATTCTTGGTTGGTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGTCAACCGCCTACCAGTAC
Primer_r	: GCACTATTCTTGGTTGGTCTG
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1532 bp
Genome contig ID	gi89161199r_55529019
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- AAAATTCAGGAATTAAAATGTGACCCTGTAATTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATAATTGATGTTTGTGTTTGGTTTGTTGTAAATATAAATTAACTCCATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	55629019	55698227	17	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1387

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information