HUGE

Gene/Protein Characteristic Table for KIAA2028

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00311
Accession No. :	AB095948
Description :	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2.
HUGO Gene Name :	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 (PLEKHH2)
Clone Name :	hg04183 [Vector Info]
Flexi ORF Clone :	pF1KA2028
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6739 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2388 bp

Genome contig ID gi89161199f_43659514
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCCCTTTCAGTCATAATAAATGATTTACAAAACCC
Flanking genome sequence
(189117 - 189166)
----+----*----+----*----+----*----+----*----+----*
ATTTTGAGCATTATCTTTTGAATAATCTTCAAGAAATACCTAATGTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 43759514 43848629 28 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1449 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IVE3	100.0	Pleckstrin homo...	Homo sapiens
EAX00293	100.0	hCG2039966, iso...	Homo sapiens
CAI46132	99.8	hypothetical pr...	Homo sapiens
CAL37417	99.6	hypothetical pr...	synthetic construct
XP_525888	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033026	6e-126	48.5	KIAA1200
AB018342	7.9e-05	21.5	KIAA0799

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 660 753 PF00169 Pleckstrin-like

IPR001849 768 875 PF00169 Pleckstrin-like

IPR000857 953 1066 PF00784 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

HMMSmart IPR001849 660 755 SM00233 Pleckstrin-like

IPR001849 768 877 SM00233 Pleckstrin-like

IPR000857 911 1066 SM00139 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1073 1310 SM00295 Band 4.1

ProfileScan IPR001849 659 753 PS50003 Pleckstrin-like

IPR001849 767 875 PS50003 Pleckstrin-like

IPR000857 911 1066 PS51016 Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4

IPR000299 1077 1407 PS50057 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	660	753	PF00169	Pleckstrin-like
IPR001849	768	875	PF00169	Pleckstrin-like
IPR000857	953	1066	PF00784	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
HMMSmart	IPR001849	660	755	SM00233	Pleckstrin-like
IPR001849	768	877	SM00233	Pleckstrin-like
IPR000857	911	1066	SM00139	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1073	1310	SM00295	Band 4.1
ProfileScan	IPR001849	659	753	PS50003	Pleckstrin-like
IPR001849	767	875	PS50003	Pleckstrin-like
IPR000857	911	1066	PS51016	Unconventional myosin/plant kinesin-like protein/non-motor protein conserved region MyTH4
IPR000299	1077	1407	PS50057	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATTTCAATCCCAGAGACTCG

Primer_r
: GAATCCTTAACTTTGGGGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2388 bp
Genome contig ID	gi89161199f_43659514
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCCCTTTCAGTCATAATAAATGATTTACAAAACCC
Flanking genome sequence (189117 - 189166)	----+--------+--------+--------+--------+----* ATTTTGAGCATTATCTTTTGAATAATCTTCAAGAAATACCTAATGTTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	43759514	43848629	28	100.0	Perfect prediction

Primer_f	: AATTTCAATCCCAGAGACTCG
Primer_r	: GAATCCTTAACTTTGGGGGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2028

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information