HUGE |
Gene/Protein Characteristic Table for KIAA2028 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00311 |
---|---|
Accession No. : | AB095948 |
Description : | pleckstrin homology domain containing, family H (with MyTH4 domain) member 2. |
HUGO Gene Name : | pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 (PLEKHH2) |
Clone Name : | hg04183 [Vector Info] |
Flexi ORF Clone : | pF1KA2028
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6739 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2388 bp Genome contig ID gi89161199f_43659514 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TCCCTTTCAGTCATAATAAATGATTTACAAAACCCFlanking genome sequence
(189117 - 189166) ----+----*----+----*----+----*----+----*----+----*
ATTTTGAGCATTATCTTTTGAATAATCTTCAAGAAATACCTAATGTTTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 43759514 43848629 28 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1449 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATTTCAATCCCAGAGACTCG | |
: GAATCCTTAACTTTGGGGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |