HUGE |
Gene/Protein Characteristic Table for KIAA2030 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05749 |
---|---|
Accession No. : | AB107352 |
Description : | |
HUGO Gene Name : | ubinuclein 2 (UBN2) |
Clone Name : | ef00583 [Vector Info] |
Source : |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7921 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4849 bp Genome contig ID gi89161213f_138496605 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCTCFlanking genome sequence
(141367 - 141416) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAATAAAAGTATAGAAAAGTATCTTTTCACAAGAGGCCACC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 138596605 138637970 13 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1023 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 7 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |