KIAA0003

Product ID	ORK01948
Accession No	D13628
Description	angiopoietin 1, transcript variant 1
Clone name	hk04939
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4211 bp) Predicted protein sequence (524 aa)
HaloTag ORF Clone	FHC01948
Flexi ORF Clone	FXC01948
Source	Human adult brain
Rouge ID	mKIAA0003 by Kazusa Mouse cDNA Project
Note	We replaced ha00055, former representative clones for KIAA0003 with hk04939. (2001/5/29)

Length: 4211 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2363 bp
Genome contig ID	gi51511724r_108230896
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAACATTATTTGATTTAAATAAAATTGAAAGTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGTGCAACTTCATTTTATTTTTAATACGTATTTTGCCAAATTTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	108330896	108579313	9	100.0	Perfect prediction

Length: 524 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15389	1.5e-189	100.0	Angiopoietin-1;...	Homo sapiens
XP_001088871	3.3e-189	99.8	angiopoietin 1 ...	Macaca mulatta
BAB91325	2.2e-188	99.8	angiopoietin-1 ...	Homo sapiens
XP_001494996	1.1e-186	98.0	similar to Angi...	Equus caballus
O08538	2.2e-186	97.6	Angiopoietin-1;...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002181	310	522	PF00147	Fibrinogen
HMMSmart	IPR002181	307	522	SM00186	Fibrinogen
ScanRegExp	IPR002181	473	485	PS00514	Fibrinogen

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGTGTCCAAGGTTATGACAG
Primer_r	GTTTGAAACTGGTATTGCTA
PCR product length	137 bp
PCR conditions	95 °C15 sec56 °C60 sec30 cycles