KIAA0041

Product ID	ORK00006
Accession No	D26069
Description	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Clone name	ha00469s1
Vector information	The cDNA fragment was originally inserted at Apa I-NotI site ... The cDNA fragment was originally inserted at Apa I-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA. This cDNA clone ha00469s1 has an unexpected insertion (T) between the vector and the cDNA.
cDNA sequence	DNA sequence (6926 bp) Predicted protein sequence (781 aa)
HaloTag ORF Clone	FHC00006
Flexi ORF Clone	FXC00006
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0041 by Kazusa Mouse cDNA Project
Note	We replaced ha00469, former representative clones for KIAA0041 with ha00469s1. (2002/12/27)

Length: 6926 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4579 bp
Genome contig ID	gi89161205r_196376764
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTACAATAAGTCAATAAAGATCTCACCTCTGGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTCTTTCATGGTGATTTACATTTTCTTGTGAAATACACTGTGAACATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	196476764	196644875	23	99.3	Perfect prediction

Length: 781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516962	100.0	centaurin, beta...	Pan troglodytes
XP_001093762	99.5	centaurin, beta...	Macaca mulatta
Q15057	100.0	ARFGAP with coi...	Homo sapiens
AAH60767	99.9	Centaurin, beta...	Homo sapiens
Q6IVG4	98.1	ARFGAP with coi...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051503	1.9e-103	61.0	KIAA1716
D30758	2.8e-80	51.5	KIAA0050
AB007860	3.2e-18	28.4	KIAA0400
AB033075	6.3e-15	30.1	KIAA1249
AB075855	3.2e-14	31.6	KIAA1975

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	414	433	PR00405	Arf GTPase activating protein
	IPR001164	433	450	PR00405	Arf GTPase activating protein
	IPR001164	454	475	PR00405	Arf GTPase activating protein
	IPR002110	677	689	PR01415	Ankyrin
	IPR002110	689	701	PR01415	Ankyrin
HMMPfam	IPR001849	270	364	PF00169	Pleckstrin-like
	IPR001164	402	523	PF01412	Arf GTPase activating protein
	IPR002110	629	640	PF00023	Ankyrin
	IPR002110	643	675	PF00023	Ankyrin
	IPR002110	676	708	PF00023	Ankyrin
	IPR002110	709	729	PF00023	Ankyrin
HMMSmart	IPR001849	270	366	SM00233	Pleckstrin-like
	IPR001164	402	523	SM00105	Arf GTPase activating protein
	IPR002110	643	672	SM00248	Ankyrin
	IPR002110	676	705	SM00248	Ankyrin
	IPR002110	709	738	SM00248	Ankyrin
ProfileScan	IPR001849	269	364	PS50003	Pleckstrin-like
	IPR001164	402	523	PS50115	Arf GTPase activating protein
	IPR002110	608	741	PS50297	Ankyrin
	IPR002110	643	675	PS50088	Ankyrin
	IPR002110	676	708	PS50088	Ankyrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GTTCATAAATGCGGTCGG
Primer_r	GGGGAATCAACCCAACAA
PCR product length	206 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles