KIAA1716

Product ID	ORK00897
Accession No	AB051503
Description	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
Clone name	hj06603
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5319 bp) Predicted protein sequence (804 aa)
HaloTag ORF Clone	FHC00897
Flexi ORF Clone	FXC00897
Source	Human adult brain
Rouge ID	mKIAA1716 by Kazusa Mouse cDNA Project

Length: 5319 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1174 bp
Genome contig ID	gi89161185r_1117633
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCACCCCTCGCTTTGAATAAAGCACTTGCGCCCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCCTGCTCCTGGGCTCCCGTGCCTTGCTCTGCTCTGTCTCCGGGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	1217633	1231172	21	99.5	Perfect prediction

Length: 804 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL04165	100.0	centaurin beta5...	Homo sapiens
Q96P50	95.6	ArfGAP with coi...	Homo sapiens
AAH51194	95.5	CENTB5 protein ...	Homo sapiens
EAW56250	95.1	centaurin, beta...	Homo sapiens
XP_001093292	94.0	similar to cent...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	4.4e-102	60.5	KIAA0041
D30758	7.4e-75	49.6	KIAA0050
AB075855	4.6e-15	41.0	KIAA1975
AB029022	8.4e-15	39.8	KIAA1099
D79989	1.4e-14	39.4	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	418	437	PR00405	Arf GTPase activating protein
	IPR001164	437	454	PR00405	Arf GTPase activating protein
	IPR001164	458	479	PR00405	Arf GTPase activating protein
	IPR002110	706	718	PR01415	Ankyrin
	IPR002110	718	730	PR01415	Ankyrin
HMMPfam	IPR001849	272	366	PF00169	Pleckstrin-like
	IPR001164	406	528	PF01412	Arf GTPase activating protein
	IPR002110	643	669	PF00023	Ankyrin
	IPR002110	672	704	PF00023	Ankyrin
	IPR002110	705	737	PF00023	Ankyrin
	IPR002110	738	758	PF00023	Ankyrin
HMMSmart	IPR001849	272	368	SM00233	Pleckstrin-like
	IPR001164	406	528	SM00105	Arf GTPase activating protein
	IPR002110	672	701	SM00248	Ankyrin
	IPR002110	705	734	SM00248	Ankyrin
ProfileScan	IPR001849	271	366	PS50003	Pleckstrin-like
	IPR001164	406	528	PS50115	Arf GTPase activating protein
	IPR002110	643	758	PS50297	Ankyrin
	IPR002110	672	704	PS50088	Ankyrin
	IPR002110	705	737	PS50088	Ankyrin

Primer_f	ACTATGTGCTCCAGATCAATG
Primer_r	CTGCCAGCTTCTTCATGTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-