KIAA0167

Product ID	ORK00439
Accession No	D79989
Description	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2, transcript variant 2
Clone name	ha01026
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3950 bp) Predicted protein sequence (844 aa)
HaloTag ORF Clone	FHC00439
Flexi ORF Clone	FXC00439
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0167 by Kazusa Mouse cDNA Project

Length: 3950 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1351 bp
Genome contig ID	gi89161190r_56305251
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CTTCTTCAACAGCAATTAAAGAGGAAGTGATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCTAGGGGGTGAGCTGCTGGTCTGTTCTTGGAGGCAGGTCAGGGCATGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	56405251	56422209	18	100.0	Perfect prediction

Length: 844 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAL04171	0	100.0	centaurin gamma...	Homo sapiens
XP_001116290	0	98.6	centaurin, gamm...	Macaca mulatta
XP_001917890	0	96.8	centaurin, gamm...	Equus caballus
XP_576238	0	95.8	similar to Cent...	Rattus norvegicus
EAW97048	6.2e-170	97.7	centaurin, gamm...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029022	7.3e-42	55.8	KIAA1099
AB075855	3.4e-36	48.5	KIAA1975
AB051503	4.4e-10	38.9	KIAA1716
D26069	2.3e-09	38.7	KIAA0041
AB033075	4.2e-09	29.8	KIAA1249

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	79	100	PR00449	Ras GTPase
	IPR001806	216	238	PR00449	Ras GTPase
	IPR001164	595	614	PR00405	Arf GTPase activating protein
	IPR001164	614	631	PR00405	Arf GTPase activating protein
	IPR001164	635	656	PR00405	Arf GTPase activating protein
	IPR002110	743	755	PR01415	Ankyrin
	IPR002110	755	767	PR01415	Ankyrin
HMMPfam	IPR013684	80	190	PF08477	Miro-like
	IPR001849	349	562	PF00169	Pleckstrin-like
	IPR001164	583	703	PF01412	Arf GTPase activating protein
	IPR002110	742	774	PF00023	Ankyrin
	IPR002110	775	800	PF00023	Ankyrin
HMMSmart	IPR003577	76	244	SM00173	Ras small GTPase
	IPR003579	79	241	SM00175	Ras small GTPase
	IPR001849	349	564	SM00233	Pleckstrin-like
	IPR001164	583	703	SM00105	Arf GTPase activating protein
ProfileScan	IPR001849	348	562	PS50003	Pleckstrin-like
	IPR001164	583	703	PS50115	Arf GTPase activating protein
	IPR002110	742	774	PS50088	Ankyrin
	IPR002110	742	799	PS50297	Ankyrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAACTGGGTGATAGGGCGGAC
Primer_r	AAGATTCACACCACTGCCTCC
PCR product length	215 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles