KIAA1099

Product ID	ORK00741
Accession No	AB029022
Description	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1, transcript variant 2
Clone name	hk07834
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk07834 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC CCACGCGTCC G) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4112 bp) Predicted protein sequence (864 aa)
HaloTag ORF Clone	FHC00741
Flexi ORF Clone	FXC00741
Source	Human adult brain
Rouge ID	mKIAA1099 by Kazusa Mouse cDNA Project

Length: 4112 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1126 bp
Genome contig ID	gi89161199f_235967595
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATGTGTGAAAATATATTTGAATAAAAGAAGTTCAT
Flanking genome sequence (731037 - 731086)	----+--------+--------+--------+--------+----* AAATATGCATTGATTTTTGTACAGACAAATGGCACCTCTCTTAATTTATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	236067499	236698630	17	99.4	Perfect prediction

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL04172	100.0	centaurin gamma...	Homo sapiens
EAW71079	99.9	centaurin, gamm...	Homo sapiens
NP_055729	99.8	centaurin, gamm...	Homo sapiens
XP_001082744	99.4	similar to cent...	Macaca mulatta
NP_001032213	97.4	centaurin, gamm...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075855	2.2e-102	82.0	KIAA1975
D79989	4.6e-48	55.8	KIAA0167
AB051503	4.8e-12	39.8	KIAA1716
AB033075	5.7e-12	31.1	KIAA1249
D26069	3.8e-11	38.7	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	132	153	PR00449	Ras GTPase
	IPR001806	171	193	PR00449	Ras GTPase
	IPR001806	229	242	PR00449	Ras GTPase
	IPR001806	267	289	PR00449	Ras GTPase
	IPR001164	628	647	PR00405	Arf GTPase activating protein
	IPR001164	647	664	PR00405	Arf GTPase activating protein
	IPR001164	668	689	PR00405	Arf GTPase activating protein
	IPR002110	776	788	PR01415	Ankyrin
	IPR002110	821	833	PR01415	Ankyrin
HMMPfam	IPR013684	133	241	PF08477	Miro-like
	IPR001849	407	595	PF00169	Pleckstrin-like
	IPR001164	616	736	PF01412	Arf GTPase activating protein
	IPR002110	775	807	PF00023	Ankyrin
	IPR002110	808	833	PF00023	Ankyrin
HMMSmart	IPR003577	129	292	SM00173	Ras small GTPase
	IPR003579	132	292	SM00175	Ras small GTPase
	IPR001849	407	597	SM00233	Pleckstrin-like
	IPR001164	616	736	SM00105	Arf GTPase activating protein
	IPR002110	775	804	SM00248	Ankyrin
	IPR002110	808	839	SM00248	Ankyrin
HMMTigr	IPR005225	129	287	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR001849	406	595	PS50003	Pleckstrin-like
	IPR001164	616	736	PS50115	Arf GTPase activating protein
	IPR002110	743	832	PS50297	Ankyrin
	IPR002110	775	807	PS50088	Ankyrin

Primer_f	CAAAGAGAGGAAATCAGTCGC
Primer_r	AGACTAACACATCCACCTCGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAAGAGAGGAAATCAGTCGC
Primer_r	AGACTAACACATCCACCTCGG
PCR product length	231 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles