|
Order Kazusa clone(s) from : |
| Product ID | ORK01973 |
|---|---|
| Accession No | AB007860 |
| Description | ArfGAP with SH3 domain, ankyrin repeat and PH domain 2, transcript variant 1 |
| Clone name | hg01091 |
| Vector information | |
| cDNA sequence | DNA sequence (5711 bp) Predicted protein sequence (1022 aa) |
|
HaloTag ORF Clone |
FHC01973
|
| Flexi ORF Clone | FXC01973 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0400
by Kazusa Mouse cDNA Project
|
Length: 5711 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Length: 1022 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001452 | 963 | 1017 | PD000066 | Src homology-3 |
| FPrintScan | IPR001164 | 449 | 468 | PR00405 | Arf GTPase activating protein |
| IPR001164 | 468 | 485 | PR00405 | Arf GTPase activating protein | |
| IPR001164 | 489 | 510 | PR00405 | Arf GTPase activating protein | |
| IPR001452 | 977 | 992 | PR00452 | Src homology-3 | |
| IPR001452 | 994 | 1003 | PR00452 | Src homology-3 | |
| IPR001452 | 1008 | 1020 | PR00452 | Src homology-3 | |
| HMMPfam | IPR001849 | 322 | 413 | PF00169 | Pleckstrin-like |
| IPR001164 | 437 | 559 | PF01412 | Arf GTPase activating protein | |
| IPR002110 | 600 | 635 | PF00023 | Ankyrin | |
| IPR002110 | 636 | 668 | PF00023 | Ankyrin | |
| IPR002110 | 669 | 689 | PF00023 | Ankyrin | |
| IPR001452 | 963 | 1017 | PF00018 | Src homology-3 | |
| HMMSmart | IPR001849 | 322 | 415 | SM00233 | Pleckstrin-like |
| IPR001164 | 437 | 557 | SM00105 | Arf GTPase activating protein | |
| IPR002110 | 600 | 632 | SM00248 | Ankyrin | |
| IPR002110 | 636 | 665 | SM00248 | Ankyrin | |
| IPR002110 | 669 | 699 | SM00248 | Ankyrin | |
| IPR001452 | 963 | 1021 | SM00326 | Src homology-3 | |
| ProfileScan | IPR001849 | 321 | 413 | PS50003 | Pleckstrin-like |
| IPR001164 | 437 | 559 | PS50115 | Arf GTPase activating protein | |
| IPR002110 | 600 | 691 | PS50297 | Ankyrin | |
| IPR002110 | 636 | 668 | PS50088 | Ankyrin | |
| IPR001452 | 960 | 1022 | PS50002 | Src homology-3 |
RT-PCR
|
|---|
Experimental conditions| Primer_f | GCTGCAACCAAAGTAATCAGG |
|---|---|
| Primer_r | GTGTGATCTGTTAAGGGGTGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 2
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GCTGCAACCAAAGTAATCAGG |
| Primer_r | GTGTGATCTGTTAAGGGGTGG |
| PCR product length | 100 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |