Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01973 |
---|---|
Accession No | AB007860 |
Description | ArfGAP with SH3 domain, ankyrin repeat and PH domain 2, transcript variant 1 |
Clone name | hg01091 |
Vector information | |
cDNA sequence | DNA sequence (5711 bp) Predicted protein sequence (1022 aa) |
HaloTag ORF Clone |
FHC01973
|
Flexi ORF Clone | FXC01973 |
Source | Human adult brain |
Rouge ID |
mKIAA0400
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 963 | 1017 | PD000066 | Src homology-3 |
FPrintScan | IPR001164 | 449 | 468 | PR00405 | Arf GTPase activating protein |
IPR001164 | 468 | 485 | PR00405 | Arf GTPase activating protein | |
IPR001164 | 489 | 510 | PR00405 | Arf GTPase activating protein | |
IPR001452 | 977 | 992 | PR00452 | Src homology-3 | |
IPR001452 | 994 | 1003 | PR00452 | Src homology-3 | |
IPR001452 | 1008 | 1020 | PR00452 | Src homology-3 | |
HMMPfam | IPR001849 | 322 | 413 | PF00169 | Pleckstrin-like |
IPR001164 | 437 | 559 | PF01412 | Arf GTPase activating protein | |
IPR002110 | 600 | 635 | PF00023 | Ankyrin | |
IPR002110 | 636 | 668 | PF00023 | Ankyrin | |
IPR002110 | 669 | 689 | PF00023 | Ankyrin | |
IPR001452 | 963 | 1017 | PF00018 | Src homology-3 | |
HMMSmart | IPR001849 | 322 | 415 | SM00233 | Pleckstrin-like |
IPR001164 | 437 | 557 | SM00105 | Arf GTPase activating protein | |
IPR002110 | 600 | 632 | SM00248 | Ankyrin | |
IPR002110 | 636 | 665 | SM00248 | Ankyrin | |
IPR002110 | 669 | 699 | SM00248 | Ankyrin | |
IPR001452 | 963 | 1021 | SM00326 | Src homology-3 | |
ProfileScan | IPR001849 | 321 | 413 | PS50003 | Pleckstrin-like |
IPR001164 | 437 | 559 | PS50115 | Arf GTPase activating protein | |
IPR002110 | 600 | 691 | PS50297 | Ankyrin | |
IPR002110 | 636 | 668 | PS50088 | Ankyrin | |
IPR001452 | 960 | 1022 | PS50002 | Src homology-3 |
RT-PCR |
---|
Primer_f | GCTGCAACCAAAGTAATCAGG |
---|---|
Primer_r | GTGTGATCTGTTAAGGGGTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTGCAACCAAAGTAATCAGG |
Primer_r | GTGTGATCTGTTAAGGGGTGG |
PCR product length | 100 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |