KIAA0078

Product ID	ORK01957
Accession No	D38551
Description	RAD21 cohesin complex component
Clone name	ha01237
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3647 bp) Predicted protein sequence (635 aa)
HaloTag ORF Clone	FHC01957
Flexi ORF Clone	FXC01957
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0078 by Kazusa Mouse cDNA Project

Length: 3647 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1567 bp
Genome contig ID	gi51511724r_117827355
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATAACTTTTCTAATAAAAGTTGTGTTATAAGCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTTTGAGTATTCATTATTCAGTTGGTGGTGGTCCCCAAGGGAAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	117927355	117956182	14	99.5	Perfect prediction

Length: 635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60216	3.2e-208	100.0	Double-strand-b...	Homo sapiens
XP_001094435	3.6e-208	99.8	RAD21 homolog i...	Macaca mulatta
CAA66940	1e-207	99.8	HR21spA [Homo s...	Homo sapiens
XP_539142	2.3e-206	98.7	similar to Doub...	Canis lupus fam...
XP_001496357	2.9e-206	98.7	similar to Doub...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006910	5	115	PF04825	Rad21/Rec8 like protein
HMMPfam	IPR006909	578	632	PF04824	Rad21/Rec8 like protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GGACACAGAACCCTTTGAGAA
Primer_r	TGAGTCCTTGGGGTGCTGTTT
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C120 sec35 cycles