Order Kazusa clone(s) from : ![]() |
Product ID | ORK00016 |
---|---|
Accession No | D43947 |
Description | KIAA0100 |
Clone name | ef04121 |
Vector information | |
cDNA sequence | DNA sequence (7393 bp) Predicted protein sequence (2235 aa) |
HaloTag ORF Clone |
FHC00016
![]() |
Flexi ORF Clone | FXC00016 |
Source | |
Rouge ID |
mKIAA0100
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00902, former representative clones for KIAA0100 with ef04121. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 610 bp |
---|---|
Genome contig ID | gi51511734r_23865616 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99983 - 99934) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 23965599 | 23996276 | 39 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006231 | 886 | 910 | PF06039 | Malate:quinone-oxidoreductase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 6 | SALLVLLLVALSALFLGRWLVVR | 28 | PRIMARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | GAACAACCTCCTCCCCAATGC |
Primer_r | CATCATCTTCCACACTTCGGC |
PCR product length | 153 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |