|
Order Kazusa clone(s) from : |
| Product ID | ORK06020 |
|---|---|
| Accession No | D50926 |
| Description | MORC family CW-type zinc finger 3 |
| Clone name | ha03621s1 |
| Vector information | |
| cDNA sequence | DNA sequence (4197 bp) Predicted protein sequence (950 aa) |
|
HaloTag ORF Clone |
FHC06020
|
| Flexi ORF Clone | FXC06020 |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0136
by Kazusa Mouse cDNA Project
|
| Note | We replaced ha03621, former representative clones for KIAA0136 with ha03621s1. (2008/8/27) |
Length: 4197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1342 bp |
|---|---|
| Genome contig ID | gi51511750f_36514398 |
| PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (156410 - 156459) |
----+----*----+----*----+----*----+----*----+----* |
Length: 950 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Chromosome No. 21
Experimental conditions| Panel name | Stanford G3 |
|---|---|
| Primer_f | CGACAATGGGAATGGTATGAC |
| Primer_r | TGCTCCGCTTTTATGACTTTC |
| PCR product length | 228 (0.9k) bp |
| PCR conditions | 95 °C 15 sec 66 °C 120 sec 30 cycles |