Order Kazusa clone(s) from : ![]() |
Product ID | ORK00423 |
---|---|
Accession No | D50929 |
Description | eukaryotic translation initiation factor 3, subunit A |
Clone name | ha04032 |
Vector information | |
cDNA sequence | DNA sequence (5276 bp) Predicted protein sequence (1388 aa) |
HaloTag ORF Clone |
FHC00423
![]() |
Flexi ORF Clone | FXC00423 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0139
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 999 bp |
---|---|
Genome contig ID | gi89161187r_120684543 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 120784543 | 120830306 | 22 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | ACCGAGAAAGAGACCGAGACC |
Primer_r | GTCCATCCATCTTCATCAGTC |
PCR product length | 121 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |