KIAA0139

Product ID	ORK00423
Accession No	D50929
Description	eukaryotic translation initiation factor 3, subunit A
Clone name	ha04032
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5276 bp) Predicted protein sequence (1388 aa)
HaloTag ORF Clone	FHC00423
Flexi ORF Clone	FXC00423
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0139 by Kazusa Mouse cDNA Project

Length: 5276 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	999 bp
Genome contig ID	gi89161187r_120684543
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTCTTCAGTGATAAATAAAATACTTACAGAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTAGTGTTGATTTGTGGTTATAGTATTTTGTTTATAATGGTAAGTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	120784543	120830306	22	99.7	Perfect prediction

Length: 1388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14152	100.0	Eukaryotic tran...	Homo sapiens
AAI14430	99.9	Eukaryotic tran...	Homo sapiens
XP_001153575	99.9	eukaryotic tran...	Pan troglodytes
BAG63833	99.7	unnamed protein...	Homo sapiens
XP_884395	94.7	eukaryotic tran...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	371	501	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	432	512	SM00088	Proteasome component region PCI

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ACCGAGAAAGAGACCGAGACC
Primer_r	GTCCATCCATCTTCATCAGTC
PCR product length	121 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles