KIAA0172

Product ID	ORK00443
Accession No	D79994
Description	KN motif and ankyrin repeat domains 1, transcript variant 1
Clone name	ha02512s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5635 bp) Predicted protein sequence (1366 aa)
HaloTag ORF Clone	FHC00443
Flexi ORF Clone	FXC00443
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0172 by Kazusa Mouse cDNA Project
Note	We replaced ha02512, former representative clones for KIAA0172 with ha02512s1. (2003/1/10)

Length: 5635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	868 bp
Genome contig ID	gi89161216f_439105
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGCCATATTTTCAAAATAAAATTCCATTAAGCTCT
Flanking genome sequence (297000 - 297049)	----+--------+--------+--------+--------+----* TTTCCTTGTCCCTGTTTCATCTCTGATAGCTGTCCGCCCCGAGCCGATTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	539101	736103	12	99.2	Terminal No-hit

Length: 1366 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09638	100.0	ankyrin repeat ...	synthetic construct
Q14678	99.9	KN motif and an...	Homo sapiens
EAW58821	99.9	ankyrin repeat ...	Homo sapiens
AAH37495	99.8	KANK1 protein [...	Homo sapiens
BAF85678	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040951	2.2e-32	44.6	KIAA1518
AB033049	0.00036	33.7	KIAA1223
AB002377	0.0007	31.7	KIAA0379

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	1281	1293	PR01415	Ankyrin
FPrintScan	IPR002110	1293	1305	PR01415	Ankyrin
HMMPfam	IPR002110	1175	1205	PF00023	Ankyrin
	IPR002110	1209	1245	PF00023	Ankyrin
	IPR002110	1247	1279	PF00023	Ankyrin
	IPR002110	1280	1313	PF00023	Ankyrin
	IPR002110	1314	1334	PF00023	Ankyrin
HMMSmart	IPR002110	971	1001	SM00248	Ankyrin
	IPR002110	1175	1205	SM00248	Ankyrin
	IPR002110	1209	1242	SM00248	Ankyrin
	IPR002110	1247	1276	SM00248	Ankyrin
	IPR002110	1280	1312	SM00248	Ankyrin
	IPR002110	1314	1342	SM00248	Ankyrin
ProfileScan	IPR002110	1169	1334	PS50297	Ankyrin
	IPR002110	1175	1197	PS50088	Ankyrin
	IPR002110	1247	1279	PS50088	Ankyrin
	IPR002110	1280	1301	PS50088	Ankyrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAGGTTGGATTGTGTTAGAGG
Primer_r	GAGGACCAAAGTAAATGTGAC
PCR product length	111 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles