KIAA0214

Product ID	ORK00462
Accession No	D86987
Description	mitofusin 2, transcript variant 1
Clone name	ha04778
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4550 bp) Predicted protein sequence (790 aa)
HaloTag ORF Clone	FHC00462
Flexi ORF Clone	FXC00462
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0214 by Kazusa Mouse cDNA Project

Length: 4550 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1954 bp
Genome contig ID	gi89161185f_11862956
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- TAAAATAAAACCTAGTTGGAAATCCAAAAAAAAAC
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	11962956	11996152	19	99.5	Terminal No-hit

Length: 790 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514395	99.6	mitofusin 2 [Pa...	Pan troglodytes
O95140	100.0	Mitofusin-2; Tr...	Homo sapiens
AAD02058	99.9	CPRP1 [Homo sap...	Homo sapiens
BAE01725	99.5	unnamed protein...	Macaca fascicularis
CAH91261	99.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001401	132	292	PF00350	Dynamin
HMMPfam	IPR006884	619	789	PF04799	Fzo-like conserved region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	654	VGGVVWKAVGWRLIALSFGLYGL	676	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCTGTTGTGTGGGGCGAAGTG
Primer_r	TGCTGTGAAGTGGCCCCTGTC
PCR product length	104 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles