Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00462 |
---|---|
Accession No | D86987 |
Description | mitofusin 2, transcript variant 1 |
Clone name | ha04778 |
Vector information | |
cDNA sequence | DNA sequence (4550 bp) Predicted protein sequence (790 aa) |
HaloTag ORF Clone |
FHC00462
|
Flexi ORF Clone | FXC00462 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0214
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1954 bp |
---|---|
Genome contig ID | gi89161185f_11862956 |
PolyA signal sequence (AATAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence | None |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 11962956 | 11996152 | 19 | 99.5 | Terminal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001401 | 132 | 292 | PF00350 | Dynamin |
IPR006884 | 619 | 789 | PF04799 | Fzo-like conserved region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 654 | VGGVVWKAVGWRLIALSFGLYGL | 676 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CCTGTTGTGTGGGGCGAAGTG |
Primer_r | TGCTGTGAAGTGGCCCCTGTC |
PCR product length | 104 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |