KIAA0257

Product ID	ORK07141
Accession No	D87446
Description	transmembrane protein 131
Clone name	ha07065
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6178 bp) Predicted protein sequence (1805 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0257 by Kazusa Mouse cDNA Project

Length: 6178 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	759 bp
Genome contig ID	gi89161199r_97639235
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTGTGTTGTACTTTGAAATAAATGATGCTTTTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGCCTTGTTTTGTGGTTTTTTTTACACACAAGGTGTATTTATTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	97739235	97891602	39	99.9	Terminal No-hit

Length: 1805 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92545	100.0	Transmembrane p...	Homo sapiens
NP_056163	100.0	RW1 protein [Ho...	Homo sapiens
EAX01916	99.9	hCG1735290, iso...	Homo sapiens
XP_515638	99.6	RW1 protein iso...	Pan troglodytes
XP_001155973	99.6	RW1 protein iso...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1040	LALYIIISGIMSALFLLVIGTAY	1062	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CATGAGATTTGCTGTTGTGCT
Primer_r	ATAAAGCATGGGGAAGACAGG
PCR product length	125 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles