KIAA0280

Product ID	ORK00492
Accession No	D87470
Description	family with sequence similarity 168, member A, transcript variant 1
Clone name	ha06179
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6837 bp) Predicted protein sequence (291 aa)
HaloTag ORF Clone	FHC00492
Flexi ORF Clone	FXC00492
Source	Human adult brain
Rouge ID	mKIAA0280 by Kazusa Mouse cDNA Project

Length: 6837 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5960 bp
Genome contig ID	gi51511727r_72689513
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACACTCAATAACTATTAAAAAAAAAATTCCCCCCC
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* AAAAAAAAGTCTTAGGTGACTAGACTGAGTGGTTCTTGGGGAGGGAGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	72789493	72986739	9	99.1	Perfect prediction

Length: 291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM18313	1.5e-79	99.6	LOC361614 (pred...	Rattus norvegicus
EDM18315	9.3e-66	99.5	LOC361614 (pred...	Rattus norvegicus
XP_001505420	1.7e-64	82.4	hypothetical pr...	Ornithorhynchus...
BAC33374	1.5e-61	96.3	unnamed protein...	Mus musculus
EDM18314	1.5e-61	95.9	LOC361614 (pred...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 11

Experimental conditions

Panel name	Genebridge 4
Primer_f	GGATCTATGGTGTGACTCAAG
Primer_r	TATGAAACAGGGAAGCAGATG
PCR product length	145 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles