KIAA0290

Product ID	ORK00498
Accession No	AB006628
Description	FCH domain only 1, transcript variant 2
Clone name	ha06644
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2979 bp) Predicted protein sequence (906 aa)
HaloTag ORF Clone	FHC00498
Flexi ORF Clone	FXC00498
Source	Human adult brain
Rouge ID	mKIAA0290 by Kazusa Mouse cDNA Project

Length: 2979 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	256 bp
Genome contig ID	gi42406306f_17626926
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTTTATTTTCTAATAAAATAAAAAAGGAAACCTTT
Flanking genome sequence (133447 - 133496)	----+--------+--------+--------+--------+----* TCCTGCTCCAGGAAGTATCCTTTGCGTTGCCAGAGAGGGGAGGAAGAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	17726919	17760371	26	99.6	Perfect prediction

Length: 906 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O14526	100.0	FCH domain only...	Homo sapiens
AAH28021	99.3	FCHO1 protein [...	Homo sapiens
BAG64632	100.0	unnamed protein...	Homo sapiens
BAH14829	99.9	unnamed protein...	Homo sapiens
XP_533878	93.4	similar to FCH ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001060	23	109	PF00611	Cdc15/Fes/CIP4
HMMSmart	IPR001060	23	109	SM00055	Cdc15/Fes/CIP4
ProfileScan	IPR001060	19	100	PS50133	Cdc15/Fes/CIP4

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTCCAGATGTGTCCGAGGCAG
Primer_r	CCTGTGGCAAACCTCCTCTTC
PCR product length	190 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles