Gene/Protein Characteristic Table for KIAA0295
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07501
Accession No AB002293
Description zinc finger protein 609
Clone name hf00226
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7326 bp)
Predicted protein sequence (981 aa)
Source Human adult brain
Rouge ID mKIAA0295 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 7326 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 981 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW77686 0 99.9 zinc finger pro...
Homo sapiens
XP_510473 0 99.9 zinc finger pro...
Pan troglodytes
EAW77688 0 99.9 zinc finger pro...
Homo sapiens
O15014 0 99.9 Zinc finger pro...
Homo sapiens
XP_001107905 0 99.0 similar to zinc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033107 3.3e-11 43.1 KIAA1281
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR007087 65 95 PS50157 Zinc finger
ScanRegExp IPR007087 67 90 PS00028 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GAGTTTTAGGGGTAGTTTTCC
Primer_r GTGAAACTATGCAGCTGGGAG
PCR conditions 95 °C15 sec62 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 15
Experimental conditions
Panel name GeneBridge 4
Primer_f GAGTTTTAGGGGTAGTTTTCC
Primer_r GTGAAACTATGCAGCTGGGAG
PCR product length 111 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp