Order Kazusa clone(s) from : ![]() |
Product ID | ORK05589 |
---|---|
Accession No | AB002295 |
Description | tectonin beta-propeller repeat containing 2 |
Clone name | hf00325 |
Vector information | |
cDNA sequence | DNA sequence (8039 bp) Predicted protein sequence (1271 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0297
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4223 bp |
---|---|
Genome contig ID | gi51511730f_101844650 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (193922 - 193971) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 101944650 | 102038570 | 17 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006624 | 805 | 836 | PF06462 | Beta-propeller repeat TECPR |
IPR006624 | 854 | 887 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1039 | 1069 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1086 | 1119 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1139 | 1170 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1182 | 1213 | PF06462 | Beta-propeller repeat TECPR | |
HMMSmart | IPR006624 | 140 | 174 | SM00706 | Beta-propeller repeat TECPR |
IPR006624 | 176 | 213 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 745 | 778 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 786 | 821 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 832 | 870 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1020 | 1055 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1063 | 1102 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1113 | 1155 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1164 | 1198 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1207 | 1241 | SM00706 | Beta-propeller repeat TECPR |
![]() |
---|
Primer_f | TTGCTCACGTTAACATGGCTG |
---|---|
Primer_r | CTCAAGAACAAGTCCTAGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTGCTCACGTTAACATGGCTG |
Primer_r | CTCAAGAACAAGTCCTAGGTC |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |