KIAA1017

Product ID	ORK02013
Accession No	AB023234
Description	Hermansky-Pudlak syndrome 5, transcript variant 2
Clone name	hk07512s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4147 bp) Predicted protein sequence (1095 aa)
HaloTag ORF Clone	FHC02013
Flexi ORF Clone	FXC02013
Source	Human adult brain
Rouge ID	mKIAA1017 by Kazusa Mouse cDNA Project
Note	We replaced hk07512, former representative clones for KIAA1017 with hk07512s1. (2002/5/10)

Length: 4147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	823 bp
Genome contig ID	gi51511727r_18157458
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AATTAAATAAAATATCTTCATATATAAATTAAGCT
Flanking genome sequence (99724 - 99675)	----+--------+--------+--------+--------+----* AATTAAAAATATTTTTCCCTGTATTTATTTAATATTTTCTAATCTGAACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	18257182	18300297	22	99.7	Perfect prediction

Length: 1095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_508314	99.6	Hermansky-Pudla...	Pan troglodytes
Q9UPZ3	99.9	Hermansky-Pudla...	Homo sapiens
BAF84352	99.8	unnamed protein...	Homo sapiens
AAO25962	100.0	HPS5 protein [H...	Homo sapiens
AAO25964	99.9	HPS5 protein mi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002327	1.2e-14	29.6	KIAA0329
AB002295	8.8e-10	30.0	KIAA0297

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ACTCTTTATCCATGACCTCAG
Primer_r	TAATCCACTAGCAACAAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTCTTTATCCATGACCTCAG
Primer_r	TAATCCACTAGCAACAAGCAG
PCR product length	165 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles