Order Kazusa clone(s) from : ![]() |
Product ID | ORK00052 |
---|---|
Accession No | AB002327 |
Description | tectonin beta-propeller repeat containing 2, transcript variant 1 |
Clone name | hg00872 |
Vector information | |
cDNA sequence | DNA sequence (6379 bp) Predicted protein sequence (1417 aa) |
HaloTag ORF Clone |
FHC00052
![]() |
Flexi ORF Clone | FXC00052 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006624 | 951 | 982 | PF06462 | Beta-propeller repeat TECPR |
IPR006624 | 1000 | 1033 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1185 | 1215 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1232 | 1265 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1285 | 1316 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1328 | 1359 | PF06462 | Beta-propeller repeat TECPR | |
HMMSmart | IPR001680 | 27 | 67 | SM00320 | WD40 repeat |
IPR001680 | 71 | 111 | SM00320 | WD40 repeat | |
IPR001680 | 119 | 161 | SM00320 | WD40 repeat | |
IPR006624 | 286 | 320 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 322 | 359 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 891 | 924 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 932 | 967 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 978 | 1016 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1166 | 1201 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1209 | 1248 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1259 | 1301 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1310 | 1344 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1353 | 1387 | SM00706 | Beta-propeller repeat TECPR |
![]() |
---|
Primer_f | AAACTGTACAAAGCACGAAGC |
---|---|
Primer_r | TGTGTCTGTTGTGCCTTGCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAACTGTACAAAGCACGAAGC |
Primer_r | TGTGTCTGTTGTGCCTTGCCC |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |