Gene/Protein Characteristic Table for KIAA0329
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00052
Accession No AB002327
Description tectonin beta-propeller repeat containing 2, transcript variant 1
Clone name hg00872
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6379 bp)
Predicted protein sequence (1417 aa)
Flexi ORF Clone FXC00052
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 6379 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1417 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_547986 0 85.8 similar to CG11...
Canis lupus fam...
BAE28012 0 81.8 unnamed protein...
Mus musculus
BAC87100 0 99.8 unnamed protein...
Homo sapiens
BAG61595 0 98.6 unnamed protein...
Homo sapiens
CAK11071 1.7e-184 51.3 novel protein [...
Danio rerio
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002295 0 100.0 KIAA0297
AB023234 4.5e-12 29.6 KIAA1017
AB037779 7.7e-06 30.1 KIAA1358
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006624 951 982 PF06462 Beta-propeller repeat TECPR
IPR006624 1000 1033 PF06462 Beta-propeller repeat TECPR
IPR006624 1185 1215 PF06462 Beta-propeller repeat TECPR
IPR006624 1232 1265 PF06462 Beta-propeller repeat TECPR
IPR006624 1285 1316 PF06462 Beta-propeller repeat TECPR
IPR006624 1328 1359 PF06462 Beta-propeller repeat TECPR
HMMSmart IPR001680 27 67 SM00320 WD40 repeat
IPR001680 71 111 SM00320 WD40 repeat
IPR001680 119 161 SM00320 WD40 repeat
IPR006624 286 320 SM00706 Beta-propeller repeat TECPR
IPR006624 322 359 SM00706 Beta-propeller repeat TECPR
IPR006624 891 924 SM00706 Beta-propeller repeat TECPR
IPR006624 932 967 SM00706 Beta-propeller repeat TECPR
IPR006624 978 1016 SM00706 Beta-propeller repeat TECPR
IPR006624 1166 1201 SM00706 Beta-propeller repeat TECPR
IPR006624 1209 1248 SM00706 Beta-propeller repeat TECPR
IPR006624 1259 1301 SM00706 Beta-propeller repeat TECPR
IPR006624 1310 1344 SM00706 Beta-propeller repeat TECPR
IPR006624 1353 1387 SM00706 Beta-propeller repeat TECPR
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AAACTGTACAAAGCACGAAGC
Primer_r TGTGTCTGTTGTGCCTTGCCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name GeneBridge 4
Primer_f AAACTGTACAAAGCACGAAGC
Primer_r TGTGTCTGTTGTGCCTTGCCC
PCR product length 128 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp