Gene/Protein Characteristic Table for KIAA0299
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04820
Accession No AB002297
Description dedicator of cytokinesis 3
Clone name hf00368
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (8063 bp)
Predicted protein sequence (1907 aa)
Source Human adult brain
Rouge ID mKIAA0299 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 8063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1907 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8IZD9 0 100.0 Dedicator of cy...
Homo sapiens
XP_516488 0 99.9 dedicator of cy...
Pan troglodytes
XP_533813 0 98.8 similar to dedi...
Canis lupus fam...
XP_001493405 0 98.4 dedicator of cy...
Equus caballus
AAI67231 0 98.1 Dedicator of cy...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB018259 6.4e-156 56.6 KIAA0716
D86964 3.9e-62 38.6 KIAA0209
AB051558 6.3e-05 23.9 KIAA1771
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010703 1320 1507 PF06920 Dedicator of cytokinesis
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TGTTCTTATGTGATGACTGCC
Primer_r CTTCAATCTCTGGACCATCTG
PCR conditions 95 °C15 sec62 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f TGTTCTTATGTGATGACTGCC
Primer_r CTTCAATCTCTGGACCATCTG
PCR product length 150 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp