KIAA0386

Product ID	ORK01079
Accession No	AB002384
Description	family with sequence similarity 65, member B, transcript variant 1
Clone name	hj00015
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5471 bp) Predicted protein sequence (1085 aa)
HaloTag ORF Clone	FHC01079
Flexi ORF Clone	FXC01079
Source	Human adult brain
Rouge ID	mKIAA0386 by Kazusa Mouse cDNA Project

Length: 5471 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2087 bp
Genome contig ID	gi89161210r_24812492
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAAGTTAAAATAAAAATTATTTTTGAATTACTAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATGTGCAGTCTGATGTTATTTTTTTTCACATGCCCTTTCTGAGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	24912492	25019174	23	99.5	Perfect prediction

Length: 1085 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW55468	99.8	chromosome 6 op...	Homo sapiens
BAG11177	100.0	FAM65B protein ...	synthetic construct
EAW55470	99.8	chromosome 6 op...	Homo sapiens
XP_001105528	97.7	similar to C27H...	Macaca mulatta
Q9Y4F9	99.7	Protein FAM65B.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067517	5.2e-19	28.8	KIAA1930

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AACTAAAAGCACCCCTCAACC
Primer_r	CTGTAGTTAGGAGGTATAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACTAAAAGCACCCCTCAACC
Primer_r	CTGTAGTTAGGAGGTATAGCC
PCR product length	204 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles