KIAA1930

Product ID	ORK04978
Accession No	AB067517
Description	family with sequence similarity 65, member A
Clone name	fj11193
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3960 bp) Predicted protein sequence (664 aa)
Source	Human fetal brain
Rouge ID	mKIAA1930 by Kazusa Mouse cDNA Project

Length: 3960 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	321 bp
Genome contig ID	gi51511732f_66029868
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTTTACAGAAAATAAAAAAGCAAAATGTCTTTCC
Flanking genome sequence (108322 - 108371)	----+--------+--------+--------+--------+----* TACATGGCCTGGTACACTCCTGACCCTCTGCTCCAACACCCTCTGGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	66129868	66138188	21	99.6	Perfect prediction

Length: 664 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH54512	3.4e-176	98.8	FAM65A protein ...	Homo sapiens
CAD38982	3.4e-176	98.8	hypothetical pr...	Homo sapiens
AAH98587	3.7e-176	98.8	FAM65A protein ...	Homo sapiens
AAI56640	4.1e-176	98.8	Family with seq...	synthetic construct
Q6ZS17	4.1e-176	98.8	Protein FAM65A.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002384	3.3e-08	28.8	KIAA0386

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CAGCTCACAGTCTTCCAGTTC
Primer_r	AGCACAACAGCCTGATCATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-