Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00067 |
---|---|
Accession No | AB007865 |
Description | fibronectin leucine rich transmembrane protein 2 |
Clone name | hg01274 |
Vector information | |
cDNA sequence | DNA sequence (7527 bp) Predicted protein sequence (706 aa) |
HaloTag ORF Clone |
FHC00067
|
Flexi ORF Clone | FXC00067 |
Source | Human adult brain |
Rouge ID |
mKIAA0405
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 207 | 220 | PR00019 | Leucine-rich repeat |
IPR001611 | 321 | 334 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR000372 | 81 | 108 | PF01462 | Leucine-rich repeat |
IPR001611 | 110 | 133 | PF00560 | Leucine-rich repeat | |
IPR001611 | 156 | 178 | PF00560 | Leucine-rich repeat | |
IPR001611 | 180 | 204 | PF00560 | Leucine-rich repeat | |
IPR001611 | 206 | 224 | PF00560 | Leucine-rich repeat | |
IPR001611 | 227 | 249 | PF00560 | Leucine-rich repeat | |
IPR001611 | 251 | 275 | PF00560 | Leucine-rich repeat | |
IPR001611 | 277 | 298 | PF00560 | Leucine-rich repeat | |
IPR001611 | 299 | 321 | PF00560 | Leucine-rich repeat | |
IPR001611 | 323 | 345 | PF00560 | Leucine-rich repeat | |
IPR000483 | 382 | 407 | PF01463 | Cysteine-rich flanking region | |
IPR003961 | 466 | 548 | PF00041 | Fibronectin | |
HMMSmart | IPR000372 | 81 | 113 | SM00013 | Leucine-rich repeat |
IPR003591 | 153 | 177 | SM00369 | Leucine-rich repeat | |
IPR003591 | 178 | 203 | SM00369 | Leucine-rich repeat | |
IPR003591 | 205 | 227 | SM00369 | Leucine-rich repeat | |
IPR003591 | 228 | 248 | SM00369 | Leucine-rich repeat | |
IPR003591 | 249 | 274 | SM00369 | Leucine-rich repeat | |
IPR003591 | 298 | 320 | SM00369 | Leucine-rich repeat | |
IPR003591 | 321 | 344 | SM00369 | Leucine-rich repeat | |
IPR000483 | 356 | 407 | SM00082 | Cysteine-rich flanking region | |
ProfileScan | IPR003961 | 466 | 556 | PS50853 | Fibronectin |
ScanRegExp | IPR013090 | 85 | 95 | PS00119 | Phospholipase A2 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 20 | SHFDFAVYFFFSFSFSHHIVFYF | 42 | SECONDARY | 23 | 2 | 479 | NDTSIQVSWLSLFTVMAYKLTWV | 501 | SECONDARY | 23 | 3 | 586 | PFLLAGLIGGAVIFVLVVLLSVF | 608 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | AATCTTTCAGCCCCTTATCAG |
---|---|
Primer_r | AGGGGCATTTGTAAAGGTGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATCTTTCAGCCCCTTATCAG |
Primer_r | AGGGGCATTTGTAAAGGTGTC |
PCR product length | 204 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |